Cart 5 Product Products 807,56 € (empty)
-
1 x LOC389458-...113,40 € -
1 x CALHM3-cal...121,50 € -
1 x Chicken...348,33 € -
1 x TMEM77-tra...113,40 € -
No products
To be determined Shipping
807,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 807,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 807,56 €
View larger 
Data sheet of SCAMP2-secretory carrier membrane protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCAMP2-secretory carrier membrane protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001376 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCAMP2 |
| Origin species: | Human |
| Product name: | SCAMP2-secretory carrier membrane protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC001376 |
| Gene id: | 10066 |
| Gene description: | secretory carrier membrane protein 2 |
| Synonyms: | secretory carrier-associated membrane protein 2; testis secretory sperm-binding protein Li 219p; secretory carrier membrane protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggctttcgacaccaaccccttcgcggacccagtggatgtaaaccccttccaggatccctctgtgacccagctgaccaacgccccgcagggcggcctggcggaattcaaccccttctcagagacaaatgcagcgacaacagttcctgtcacccaactccctgggtcctcacagccagcggttctccagccatcagtggaaccaacccagccgaccccccaggccgtggtgtctgcagcccaggcaggcctgctccggcagcaggaagaactggacaggaaagctgccgagctggaacgcaaggagcgggagctgcagaacactgtagccaacttgcatgtgagacagaacaactggccccctctgccctcgtggtgccctgtgaagccctgcttctatcaggatttctccacagagatccctgccgactaccagcggatatgcaagatgctctactatctgtggatgttgcattcagtgactctgtttctgaacctgcttgcctgcctggcctggttctcgggcaacagctccaagggagtggactttggcctctccatcctgtggtttctgatcttcactccctgtgccttcctttgttggtaccgacccatctataaggcctttaggtccgacaactctttcagcttctttgtgttcttctttgtatttttttgtcaaatagggatctacatcatccagttggttggcatccctggcctgggggacagcggttggattgcagccctgtctacactggataatcattccctggccatatcagtcatcatgatggtggtggctggcttcttcaccctctgtgccgtgctctcagtcttcctcctgcagcgggtgcactccctctaccgacggacaggggccagcttccagcaggcccaggaggagttttcccagggcatcttcagcagcagaaccttccacagagctgcttcatctgctgcccaaggagccttccaggggaattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 35, member B4 - butyrophilin, subfamily 3, member A2 - solute carrier family 35, member C2 - coiled-coil domain containing 109A |