SCAMP2-secretory carrier membrane protein 2 Gene View larger

SCAMP2-secretory carrier membrane protein 2 Gene

PTXBC001376

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAMP2-secretory carrier membrane protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCAMP2-secretory carrier membrane protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001376
Product type: DNA & cDNA
Ncbi symbol: SCAMP2
Origin species: Human
Product name: SCAMP2-secretory carrier membrane protein 2 Gene
Size: 2ug
Accessions: BC001376
Gene id: 10066
Gene description: secretory carrier membrane protein 2
Synonyms: secretory carrier-associated membrane protein 2; testis secretory sperm-binding protein Li 219p; secretory carrier membrane protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggctttcgacaccaaccccttcgcggacccagtggatgtaaaccccttccaggatccctctgtgacccagctgaccaacgccccgcagggcggcctggcggaattcaaccccttctcagagacaaatgcagcgacaacagttcctgtcacccaactccctgggtcctcacagccagcggttctccagccatcagtggaaccaacccagccgaccccccaggccgtggtgtctgcagcccaggcaggcctgctccggcagcaggaagaactggacaggaaagctgccgagctggaacgcaaggagcgggagctgcagaacactgtagccaacttgcatgtgagacagaacaactggccccctctgccctcgtggtgccctgtgaagccctgcttctatcaggatttctccacagagatccctgccgactaccagcggatatgcaagatgctctactatctgtggatgttgcattcagtgactctgtttctgaacctgcttgcctgcctggcctggttctcgggcaacagctccaagggagtggactttggcctctccatcctgtggtttctgatcttcactccctgtgccttcctttgttggtaccgacccatctataaggcctttaggtccgacaactctttcagcttctttgtgttcttctttgtatttttttgtcaaatagggatctacatcatccagttggttggcatccctggcctgggggacagcggttggattgcagccctgtctacactggataatcattccctggccatatcagtcatcatgatggtggtggctggcttcttcaccctctgtgccgtgctctcagtcttcctcctgcagcgggtgcactccctctaccgacggacaggggccagcttccagcaggcccaggaggagttttcccagggcatcttcagcagcagaaccttccacagagctgcttcatctgctgcccaaggagccttccaggggaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 35, member B4
- butyrophilin, subfamily 3, member A2
- solute carrier family 35, member C2
- coiled-coil domain containing 109A

Buy SCAMP2-secretory carrier membrane protein 2 Gene now

Add to cart