BTN3A2-butyrophilin, subfamily 3, member A2 Gene View larger

BTN3A2-butyrophilin, subfamily 3, member A2 Gene

PTXBC002832

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BTN3A2-butyrophilin, subfamily 3, member A2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BTN3A2-butyrophilin, subfamily 3, member A2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002832
Product type: DNA & cDNA
Ncbi symbol: BTN3A2
Origin species: Human
Product name: BTN3A2-butyrophilin, subfamily 3, member A2 Gene
Size: 2ug
Accessions: BC002832
Gene id: 11118
Gene description: butyrophilin, subfamily 3, member A2
Synonyms: BT3.2; BTF4; BTN3.2; CD277; butyrophilin subfamily 3 member A2; butyrophilin protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaagttccctggctttccttctgctcaactttcatgtctccctcctcttggtccagctgctcactccttgctcagctcagttttctgtgcttggaccctctgggcccatcctggccatggtgggtgaagacgctgatctgccctgtcacctgttcccgaccatgagtgcagagaccatggagctgaagtgggtaagttccagcctaaggcaggtggtgaacgtgtatgcagatggaaaggaagtggaagacaggcagagtgcaccgtatcgagggagaacttcgattctgcgggatggcatcactgcagggaaggctgctctccgaatacacaacgtcacagcctctgacagtggaaagtacttgtgttatttccaagatggtgacttctatgaaaaagccctggtggagctgaaggttgcagcactgggttctaatcttcacgtcgaagtgaagggttatgaggatggagggatccatctggagtgcaggtccaccggctggtacccccaaccccaaatacagtggagcaacgccaagggagagaacatcccagctgtggaagcacctgtggttgcagatggagtgggcctatatgaagtagcagcatctgtgatcatgagaggcggctccggggagggtgtatcctgcatcatcagaaattccctcctcggcctggaaaagacagccagcatttccatcgcagaccccttcttcaggagcgcccagccctggatcgcagccctggcagggaccctgcctatcttgctgctgcttctcgccggagccagttacttcttgtggagacaacagaaggaaataactgctctgtccagtgagatagaaagtgagcaagagatgaaagaaatgggatatgctgcaacagagcgggaaataagcctaagagagagcctccaggaggaactcaagaggaaaaaaatccagtacttgactcgtggagaggagtcttcgtccgataccaataagtcagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 35, member C2
- coiled-coil domain containing 109A
- solute carrier family 35, member F2
- potassium channel modulatory factor 1

Buy BTN3A2-butyrophilin, subfamily 3, member A2 Gene now

Add to cart