SLC35B4-solute carrier family 35, member B4 Gene View larger

SLC35B4-solute carrier family 35, member B4 Gene

PTXBC008413

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC35B4-solute carrier family 35, member B4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC35B4-solute carrier family 35, member B4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008413
Product type: DNA & cDNA
Ncbi symbol: SLC35B4
Origin species: Human
Product name: SLC35B4-solute carrier family 35, member B4 Gene
Size: 2ug
Accessions: BC008413
Gene id: 84912
Gene description: solute carrier family 35, member B4
Synonyms: YEA; YEA4; UDP-xylose and UDP-N-acetylglucosamine transporter; UDP-Xylose/N-Acetylglucosamine transporter; YEA4 homolog; solute carrier family 35 (UDP-xylose/UDP-N-acetylglucosamine transporter), member B4; solute carrier family 35 member B4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgcccggccttggcggtgggcctggtgttcgcaggctgctgcagtaacgtgatcttcctagagctcctggcccggaagcatccaggatgtgggaacattgtgacatttgcacaatttttatttattgctgtggaaggcttcctctttgaagctgatttgggaaggaagccaccagctatcccaataaggtactatgccataatggtgaccatgttcttcaccgtgagcgtggtgaacaactatgccctgaatctcaacattgccatgcccctgcatatgatatttagatccggttctctaattgccaacatgattctaggaattatcattttgaagaaaagatacagtatattcaaatatacctccattgccctggtgtctgtggggatatttatttgcacttttatgtcagcaaagcaggtgacttcccagtccagcttgagtgagaatgatggattccaggcatttgtgtggtggttactaggtattggggcattgacttttgctcttctgatgtcagcaaggatggggatattccaagagactctctacaaacgatttgggaaacactccaaggaggctttgttttataatcacgcccttccacttccgggtttcgtcttcttggcttctgatatttatgaccatgcagttctattcaataagtctgagttatatgaaattcccgtcatcggagtgaccctgcccatcatgtggttctacctcctcatgaacatcatcactcagtacgtgtgcatccggggtgtgtttatcctcaccacggaatgcgcctccctcaccgtcacgctcgtcgtgaccctacgcaaatttgtgagcctcatcttttccatcttgtacttccagaaccccttcaccctgtggcactggctgggcaccttgtttgtcttcattgggaccttaatgtacacagaggtgtggaacaacctagggaccacaaaaagtgagcctcagaaggacagcaagaagaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - butyrophilin, subfamily 3, member A2
- solute carrier family 35, member C2
- coiled-coil domain containing 109A
- solute carrier family 35, member F2

Buy SLC35B4-solute carrier family 35, member B4 Gene now

Add to cart