PXMP3-peroxisomal membrane protein 3, 35kDa Gene View larger

PXMP3-peroxisomal membrane protein 3, 35kDa Gene

PTXBC005375

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PXMP3-peroxisomal membrane protein 3, 35kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PXMP3-peroxisomal membrane protein 3, 35kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005375
Product type: DNA & cDNA
Ncbi symbol: PXMP3
Origin species: Human
Product name: PXMP3-peroxisomal membrane protein 3, 35kDa Gene
Size: 2ug
Accessions: BC005375
Gene id: 5828
Gene description: peroxisomal membrane protein 3, 35kDa
Synonyms: PXMP3; PAF1; PBD5A; PBD5B; PMP3; PMP35; RNF72; ZWS3; peroxisome biogenesis factor 2; 35 kDa peroxisomal membrane protein; RING finger protein 72; peroxisomal membrane protein 3, 35kDa; peroxisome assembly factor 1; peroxisomal biogenesis factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccagaaaagagaatgcgaagagtgcaaacagagtgctaagaataagccagttggatgcacttgaactaaacaaggccctggagcagctagtttggtcccagtttactcagtgctttcatggatttaaacctgggctgttagctcgctttgagccagaggtgaaagcgtgcttatgggttttcttgtggagattcaccatctactccaaaaatgccacagtgggacagtcagttttgaatattaagtacaaaaatgatttttcccctaacctgagatatcagccacccagtaaaaatcaaaaaatctggtatgctgtttgtacaattggtggcaggtggttagaagaacgatgctatgatttgtttcgaaaccatcatttagcatcatttgggaaagtcaagcagtgtgtgaattttgtgattggacttttgaaattaggtgggctgattaattttttgattttccttcagaggggaaagtttgcaactttgacagaacgtctcctaggtattcattctgtattttgcaagcctcaaaacatacgtgaagttggctttgaatacatgaatagggaacttctctggcatggttttgctgaatttctgatttttctcttaccacttatcaatgtccagaagttgaaagccaagctgtcttcatggtgtattcctcttactggtgcacctaatagtgacaatacattagccaccagtggcaaagaatgcgctctatgtggagagtggcccaccatgcctcacaccataggatgtgagcatattttctgttatttctgtgctaagagtagtttcttatttgacgtgtactttacttgtcctaagtgtggcacagaagtacacagtctgcagccactgaaatcaggaatcgagatgtcagaagtaaatgctctttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - retinol dehydrogenase 5 (11-cis/9-cis)
- solute carrier family 35, member A4
- secretory carrier membrane protein 2
- solute carrier family 35, member B4

Buy PXMP3-peroxisomal membrane protein 3, 35kDa Gene now

Add to cart