Login to display prices
Login to display prices
GINS3-GINS complex subunit 3 (Psf3 homolog) Gene View larger

GINS3-GINS complex subunit 3 (Psf3 homolog) Gene

PTXBC005879

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GINS3-GINS complex subunit 3 (Psf3 homolog) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GINS3-GINS complex subunit 3 (Psf3 homolog) Gene

Proteogenix catalog: PTXBC005879
Ncbi symbol: GINS3
Product name: GINS3-GINS complex subunit 3 (Psf3 homolog) Gene
Size: 2ug
Accessions: BC005879
Gene id: 64785
Gene description: GINS complex subunit 3 (Psf3 homolog)
Synonyms: PSF3; DNA replication complex GINS protein PSF3; GINS complex subunit 3 (Psf3 homolog); GINS complex subunit 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcagaggcttatttccgagtggagtcgggtgcgctggggcctgaggagaactttctttctttggacgacatcctgatgtcccacgagaagctgccggtgcgcacggagaccgccatgcctcgccttggcgctttcttcctggagcggagcgcaggcgccgagactgacaacgcggtcccacagggttccaagcttgaactacccttgtggctggcaaaaggactttttgacaacaagcgacggatcctttctgtggaactccccaagatctaccaagagggttggaggactgtgttcagtgcagatcccaatgtggtggacctccacaaaatggggccccatttctacgggtttggctcccagctcctgcattttgacagtcccgagaatgcagacatttcccagtctctgctgcagacttttatcggacgttttcgccgcatcatggactcctcacagaatgcttacaacgaagacacttcagccctggtagccaggctagacgagatggagaggggcttatttcaaacagggcagaaaggactgaatgactttcagtgttgggagaaggggcaggcttctcagatcacagcttccaacctcgttcagaattacaagaagagaaaattcactgatatggaagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: