Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GINS3-GINS complex subunit 3 (Psf3 homolog) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GINS3-GINS complex subunit 3 (Psf3 homolog) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005879 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GINS3 |
| Origin species: | Human |
| Product name: | GINS3-GINS complex subunit 3 (Psf3 homolog) Gene |
| Size: | 2ug |
| Accessions: | BC005879 |
| Gene id: | 64785 |
| Gene description: | GINS complex subunit 3 (Psf3 homolog) |
| Synonyms: | PSF3; DNA replication complex GINS protein PSF3; GINS complex subunit 3 (Psf3 homolog); GINS complex subunit 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagaggcttatttccgagtggagtcgggtgcgctggggcctgaggagaactttctttctttggacgacatcctgatgtcccacgagaagctgccggtgcgcacggagaccgccatgcctcgccttggcgctttcttcctggagcggagcgcaggcgccgagactgacaacgcggtcccacagggttccaagcttgaactacccttgtggctggcaaaaggactttttgacaacaagcgacggatcctttctgtggaactccccaagatctaccaagagggttggaggactgtgttcagtgcagatcccaatgtggtggacctccacaaaatggggccccatttctacgggtttggctcccagctcctgcattttgacagtcccgagaatgcagacatttcccagtctctgctgcagacttttatcggacgttttcgccgcatcatggactcctcacagaatgcttacaacgaagacacttcagccctggtagccaggctagacgagatggagaggggcttatttcaaacagggcagaaaggactgaatgactttcagtgttgggagaaggggcaggcttctcagatcacagcttccaacctcgttcagaattacaagaagagaaaattcactgatatggaagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GrpE-like 1, mitochondrial (E. coli) - coiled-coil domain containing 109B - carbonic anhydrase III, muscle specific - GATA zinc finger domain containing 1 |