Login to display prices
Login to display prices
GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene View larger

GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene

PTXBC024242

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene

Proteogenix catalog: PTXBC024242
Ncbi symbol: GRPEL1
Product name: GRPEL1-GrpE-like 1, mitochondrial (E. coli) Gene
Size: 2ug
Accessions: BC024242
Gene id: 80273
Gene description: GrpE-like 1, mitochondrial (E. coli)
Synonyms: GrpE; HMGE; mt-GrpE#1; grpE protein homolog 1, mitochondrial; GrpE-like protein cochaperone; GrpE like 1, mitochondrial
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggctcagtgcgtgaggttggcgcggcgcagtcttcctgctttggcgttgtctctcaggccatctccccggttgttgtgcacagccacgaaacaaaagaacagtggccagaacctggaagaggacatgggtcagagtgaacagaaggcagatcctcctgctacagagaagaccctcctggaagagaaggtcaagttggaggaacagctgaaggagactgtggaaaaatataaacgagctttggcagacactgagaacttacggcagaggagccagaaattggtggaggaggcaaaattatacggcattcaagccttctgcaaggacttgttggaggtggcagacgttctggagaaggcaacacagtgtgttccaaaagaagaaattaaagacgataaccctcacctgaagaacctctatgaggggctggtcatgactgaagtccagatccagaaggtgttcacaaagcatggcttgctcaagttgaaccctgtcggagccaagttcgacccttatgaacatgaggccttgttccacacaccggttgaggggaaggagccaggcacagtggccctagttagcaaagtggggtacaagctgcatgggcgcactctgagacccgccctggtgggggtggtgaaggaagcttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: