CCDC109B-coiled-coil domain containing 109B Gene View larger

CCDC109B-coiled-coil domain containing 109B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC109B-coiled-coil domain containing 109B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC109B-coiled-coil domain containing 109B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002633
Product type: DNA & cDNA
Ncbi symbol: CCDC109B
Origin species: Human
Product name: CCDC109B-coiled-coil domain containing 109B Gene
Size: 2ug
Accessions: BC002633
Gene id: 55013
Gene description: coiled-coil domain containing 109B
Synonyms: CCDC109B; calcium uniporter regulatory subunit MCUb, mitochondrial; coiled-coil domain containing 109B; coiled-coil domain-containing protein 109B; mitochondrial calcium uniporter regulatory subunit MCUb; mitochondrial calcium uniporter dominant negative beta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgtcaacagttggttcattccttcaggacctacaaaatgaagataagggtatcaaaactgcagccatcttcacagcagatggcaacatgatttcagcttctaccttgatggatattttgctaatgaatgattttaaacttgtcattaataaaatagcatatgatgtgcagtgtccaaagagagaaaaaccaagtaatgagcacactgctgagatggaacacatgaaatccttggttcacagactatttacaatcttgcatttagaagagtctcagaaaaagagagagcaccatttactggagaaaattgaccacctgaaggaacagctgcagccccttgaacaggtgaaagctggaatagaagctcattcggaagccaaaaccagtggactcctgtgggctggattggcactgctgtccattcagggtggggcactggcctggctcacgtggtgggtgtactcctgggatatcatggagccagttacatacttcatcacatttgcaaattctatggtcttttttgcatactttatagtcactcgacaggattatacttactcagctgttaagagtaggcaatttcttcagttcttccacaagaaatcaaagcaacagcactttgatgtgcagcaatacaacaagttaaaagaagaccttgctaaggctaaagaatccctgaaacaggcgcgtcattctctctgtttgcaaatgcaagtagaagaactcaatgaaaagaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbonic anhydrase III, muscle specific
- GATA zinc finger domain containing 1
- splicing factor 3b, subunit 3, 130kDa
- steroidogenic acute regulatory protein

Buy CCDC109B-coiled-coil domain containing 109B Gene now

Add to cart