Login to display prices
Login to display prices
CCDC109B-coiled-coil domain containing 109B Gene View larger

CCDC109B-coiled-coil domain containing 109B Gene

PTXBC002633

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CCDC109B-coiled-coil domain containing 109B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCDC109B-coiled-coil domain containing 109B Gene

Proteogenix catalog: PTXBC002633
Ncbi symbol: CCDC109B
Product name: CCDC109B-coiled-coil domain containing 109B Gene
Size: 2ug
Accessions: BC002633
Gene id: 55013
Gene description: coiled-coil domain containing 109B
Synonyms: CCDC109B; calcium uniporter regulatory subunit MCUb, mitochondrial; coiled-coil domain containing 109B; coiled-coil domain-containing protein 109B; mitochondrial calcium uniporter regulatory subunit MCUb; mitochondrial calcium uniporter dominant negative beta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgtcaacagttggttcattccttcaggacctacaaaatgaagataagggtatcaaaactgcagccatcttcacagcagatggcaacatgatttcagcttctaccttgatggatattttgctaatgaatgattttaaacttgtcattaataaaatagcatatgatgtgcagtgtccaaagagagaaaaaccaagtaatgagcacactgctgagatggaacacatgaaatccttggttcacagactatttacaatcttgcatttagaagagtctcagaaaaagagagagcaccatttactggagaaaattgaccacctgaaggaacagctgcagccccttgaacaggtgaaagctggaatagaagctcattcggaagccaaaaccagtggactcctgtgggctggattggcactgctgtccattcagggtggggcactggcctggctcacgtggtgggtgtactcctgggatatcatggagccagttacatacttcatcacatttgcaaattctatggtcttttttgcatactttatagtcactcgacaggattatacttactcagctgttaagagtaggcaatttcttcagttcttccacaagaaatcaaagcaacagcactttgatgtgcagcaatacaacaagttaaaagaagaccttgctaaggctaaagaatccctgaaacaggcgcgtcattctctctgtttgcaaatgcaagtagaagaactcaatgaaaagaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: