Login to display prices
Login to display prices
LYG1-lysozyme G-like 1 Gene View larger

LYG1-lysozyme G-like 1 Gene

PTXBC029126

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYG1-lysozyme G-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LYG1-lysozyme G-like 1 Gene

Proteogenix catalog: PTXBC029126
Ncbi symbol: LYG1
Product name: LYG1-lysozyme G-like 1 Gene
Size: 2ug
Accessions: BC029126
Gene id: 129530
Gene description: lysozyme G-like 1
Synonyms: SALW1939; lysozyme g-like protein 1; lysozyme G-like 1; lysozyme g1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgcattgtggctgctgctgggcctccttgccctgatggacttgtctgaaagcagcaactggggatgctatggaaacatccaaagcctggacacccctggagcatcttgtgggattggaagacgtcacggcctgaactactgtggagttcgtgcttctgaaaggctggctgaaatagacatgccatacctcctgaaatatcaacccatgatgcaaaccattggccaaaagtactgcatggatcctgccgtgatcgctggtgtcttgtccaggaagtctcccggtgacaaaattctggtcaacatgggcgataggactagcatggtgcaggaccctggctctcaagctcccacatcctggattagtgagtctcaggtttcccagacaactgaagttctgactactagaatcaaagaaatccagaggaggtttccaacctggacccctgaccagtacctgagaggtggactctgtgcctacagtgggggtgctggctatgtccgaagcagccaggacctgagctgtgacttctgcaatgatgtccttgcacgagccaagtacctcaagagacatggcttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice