LYG1-lysozyme G-like 1 Gene View larger

LYG1-lysozyme G-like 1 Gene

PTXBC029126

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LYG1-lysozyme G-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LYG1-lysozyme G-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029126
Product type: DNA & cDNA
Ncbi symbol: LYG1
Origin species: Human
Product name: LYG1-lysozyme G-like 1 Gene
Size: 2ug
Accessions: BC029126
Gene id: 129530
Gene description: lysozyme G-like 1
Synonyms: SALW1939; lysozyme g-like protein 1; lysozyme G-like 1; lysozyme g1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgcattgtggctgctgctgggcctccttgccctgatggacttgtctgaaagcagcaactggggatgctatggaaacatccaaagcctggacacccctggagcatcttgtgggattggaagacgtcacggcctgaactactgtggagttcgtgcttctgaaaggctggctgaaatagacatgccatacctcctgaaatatcaacccatgatgcaaaccattggccaaaagtactgcatggatcctgccgtgatcgctggtgtcttgtccaggaagtctcccggtgacaaaattctggtcaacatgggcgataggactagcatggtgcaggaccctggctctcaagctcccacatcctggattagtgagtctcaggtttcccagacaactgaagttctgactactagaatcaaagaaatccagaggaggtttccaacctggacccctgaccagtacctgagaggtggactctgtgcctacagtgggggtgctggctatgtccgaagcagccaggacctgagctgtgacttctgcaatgatgtccttgcacgagccaagtacctcaagagacatggcttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MARCKS-like 1
- docking protein 5
- sorting nexin 10
- adenylate kinase 3

Buy LYG1-lysozyme G-like 1 Gene now

Add to cart