Login to display prices
Login to display prices
DOK5-docking protein 5 Gene View larger

DOK5-docking protein 5 Gene

PTXBC008992

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DOK5-docking protein 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DOK5-docking protein 5 Gene

Proteogenix catalog: PTXBC008992
Ncbi symbol: DOK5
Product name: DOK5-docking protein 5 Gene
Size: 2ug
Accessions: BC008992
Gene id: 55816
Gene description: docking protein 5
Synonyms: C20orf180; IRS-6; IRS6; docking protein 5; downstream of tyrosine kinase 5; insulin receptor substrate 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtgtgtaggaacacggatcaatgacatcagccttggagagcctgacttactggccactggggttgagagagaacagagtgagagattcaatgtgtatttgatgccatctcctaacttagatgtacatggcgaatgtgccttgcagattacatatgagtatatctgtctttgggacgtccagaatcccagagtcaaactcatctcttggccgctaagcgccctgcggcggtatggacgtgatactacgtggttcacttttgaggcagggaggatgtgtgagactggtgaagggctgtttatctttcagacccgagacggggaggccatctatcagaaagtccactctgctgccttggccatagccgagcagcacgagcgcttgctacagagtgtgaaaaactcgatgctccagatgaagatgagtgagcgggccgcctcgctgagcaccatggtgcccctgcctcgcagcgcctactggcagcacatcacacggcagcacagcacgggacagctctaccgcttgcaagatgtttccagccctctgaagcttcatcgaacagagacttttccagcctacagatctgagcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice