AK3-adenylate kinase 3 Gene View larger

AK3-adenylate kinase 3 Gene

PTXBC013771

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AK3-adenylate kinase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AK3-adenylate kinase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013771
Product type: DNA & cDNA
Ncbi symbol: AK3
Origin species: Human
Product name: AK3-adenylate kinase 3 Gene
Size: 2ug
Accessions: BC013771
Gene id: 50808
Gene description: adenylate kinase 3
Synonyms: GTP:AMP phosphotransferase AK3, mitochondrial; AK3L1; AK6; AKL3L; AKL3L1; FIX; GTP:AMP phosphotransferase, mitochondrial; adenylate kinase 3 alpha-like 1; adenylate kinase 6, adenylate kinase 3 like 1; adenylate kinase 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggcgtccgcgcggctgctgcgagcggtgatcatgggggccccgggctcgggcaagggcaccgtgtcgtcgcgcatcactacacacttcgagctgaagcacctctccagcggggacctgctccgggacaacatgctgcggggcacagaaattggcgtgttagccaaggctttcattgaccaagggaaactcatcccagatgatgtcatgactcggctggcccttcatgagctgaaaaatctcacccagtatagctggctgttggatggttttccaaggacacttccacaggcagaagccctagatagagcttatcagatcgacacagtgattaacctgaatgtgccctttgaggtcattaaacaacgccttactgctcgctggattcatcccgccagtggccgagtctataacattgaattcaaccctcccaaaactgtgggcattgatgacctgactggggagcctctcattcagcgtgaggatgataaaccagagacggttatcaagagactaaaggcttatgaagaccaaacaaagccagtcctggaatattaccagaaaaaaggggtgctggaaacattctccggaacagaaaccaacaagatttggccctatgtatatgctttcctacaaactaaagttccacaaagaagccagaaagcttcagttactccatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ropporin 1-like
- MAX-like protein X
- tetraspanin 14
- tetraspanin 18

Buy AK3-adenylate kinase 3 Gene now

Add to cart