TSPAN14-tetraspanin 14 Gene View larger

TSPAN14-tetraspanin 14 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN14-tetraspanin 14 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN14-tetraspanin 14 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002920
Product type: DNA & cDNA
Ncbi symbol: TSPAN14
Origin species: Human
Product name: TSPAN14-tetraspanin 14 Gene
Size: 2ug
Accessions: BC002920
Gene id: 81619
Gene description: tetraspanin 14
Synonyms: DC-TM4F2; TM4SF14; tetraspanin-14; tetraspanin similar to TM4SF9; transmembrane 4 superfamily member 14; tspan-14; tetraspanin 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcactattatagatactctaacgccaaggtcagctgctggtacaagtacctccttttcagctacaacatcatcttctggggtgtgctgtccgacctcaccaaagtgacccggatgcatggaatcgaccctgtggtgctggtcctgatggtgggcgtggtgatgttcaccctggggttcgccggctgcgtgggggctctgcgggagaatatctgcttgctcaactttttctgtggcaccatcgtgctcatcttcttcctggagctggctgtggccgtgctggccttcctgttccaggactgggtgagggaccggttccgggagttcttcgagagcaacatcaagtcctaccgggacgatatcgatctgcaaaacctcatcgactcccttcagaaagctaaccagtgctgtggcgcatatggccctgaagactgggacctcaacgtctacttcaattgcagcggtgccagctacagccgagagaagtgcggggtccccttctcctgctgcgtgccagatcctgcgcaaaaagttgtgaacacacagtgtggatatgatgtcaggattcagctgaagagcaagtgggatgagtccatcttcacgaaaggctgcatccaggcgctggaaagctggctcccgcggaacatttacattgtggctggcgtcttcatcgccatctcgctgttgcagatatttggcatcttcctggcaaggacgctgatctcagacatcgaggcagtgaaggccggccatcacttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetraspanin 18
- tetraspanin 12
- GPN-loop GTPase 2
- fibrinogen-like 1

Buy TSPAN14-tetraspanin 14 Gene now

Add to cart