GPN2-GPN-loop GTPase 2 Gene View larger

GPN2-GPN-loop GTPase 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPN2-GPN-loop GTPase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GPN2-GPN-loop GTPase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007815
Product type: DNA & cDNA
Ncbi symbol: GPN2
Origin species: Human
Product name: GPN2-GPN-loop GTPase 2 Gene
Size: 2ug
Accessions: BC007815
Gene id: 54707
Gene description: GPN-loop GTPase 2
Synonyms: ATPBD1B; GPN-loop GTPase 2; ATP-binding domain 1 family member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaggggccgctccgaccacggccttcgggcaggcggtgatcggcccgccgggctcagggaagaccacgtactgcctgggcatgagtgagttcctgcgcgcgctgggccggcgcgtggcggtggtgaacctggacccggccaacgaggggctgccgtacgagtgtgccgtggacgtgggcgagctggtggggctgggcgacgtgatggacgcgctgcgcctggggcccaacggcggcctgctctactgcatggagtacctggaagccaacctggactggctgcgtgccaagctcgaccccctccgcggccactacttcctcttcgactgcccaggccaggtggagctctgcacgcatcacggcgccttgcgcagcatcttctcccaaatggcgcagtgggacctcaggctgactgccgtccacctcgtggattctcactactgcacagaccctgccaagttcatttcagtactgtgtacctccctggccaccatgctgcacgtggaactgccccacatcaacctcctttccaagatggacctcattgagcattatgggaagctggccttcaacctggactactacacagaggttctggacctctcctacctgcttgaccacctggcttctgaccctttcttccgccactaccgccagctcaatgagaagctagtgcagctcatcgaagactatagccttgtctcctttatccctctcaacatccaggacaaggagagcatccagcgagtcctgcaggctgtggataaagccaatggatactgtttcggagcccaagagcagcgaagcttggaagccatgatgtctgccgcaatgggagccgacttccatttctcttccacactgggcatccaggagaagtacctggcaccctcgaaccagtcagtggagcaggaagccatgcagctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fibrinogen-like 1
- transaldolase 1
- PDZ binding kinase
- docking protein 4

Buy GPN2-GPN-loop GTPase 2 Gene now

Add to cart