TSPAN12-tetraspanin 12 Gene View larger

TSPAN12-tetraspanin 12 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN12-tetraspanin 12 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN12-tetraspanin 12 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031265
Product type: DNA & cDNA
Ncbi symbol: TSPAN12
Origin species: Human
Product name: TSPAN12-tetraspanin 12 Gene
Size: 2ug
Accessions: BC031265
Gene id: 23554
Gene description: tetraspanin 12
Synonyms: EVR5; NET-2; NET2; TM4SF12; tetraspanin-12; tetraspan NET-2; transmembrane 4 superfamily member 12; tspan-12; tetraspanin 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagagaagattccgtgaagtgtctgcgctgcctgctctacgccctcaatctgctcttttggttaatgtccatcagtgtgttggcagtttctgcttggatgagggactacctaaataatgttctcactttaactgcagaaacgagggtagaggaagcagtcatttcgacttactttcctgtggttcatccggtcatgattgctgtttgctgtttccttatcattgtggggatgttaggatattgtggaacggtgaaaagaaatctgttgcttcttgcatggtactttggaagtttgcttgtcattttctgtgtagaactggcttgtggcgtttggacatatgaacaggaacttatggttccagtacaatggtcagatatggtcactttgaaagccaggatgacaaattatggattacctagatatcggtggcttactcatgcttggaatttttttcagagagagtttaagtgctgtggagtagtatatttcactgactggttggaaatgacagagatggactggcccccagattcctgctgtgttagagaattcccaggatgttccaaacaggcccaccaggaagatctcagtgacctttatcaagagggttgtgggaagaaaatgtattcctttttgagaggaaccaaacaactgcaggtgctgaggtttctgggaatctccattggggtgacacaaatcctggccatgattctcaccattactctgctctgggctctgtattatgatagaagggagcctgggacagaccaaatgatgtccttgaagaatgacaactctcagcacctgtcatgtccctcagtagaactgttgaaaccaagcctgtcaagaatctttgaacacacatccatggcaaacagctttaatacacactttgagatggaggagttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - GPN-loop GTPase 2
- fibrinogen-like 1
- transaldolase 1
- PDZ binding kinase

Buy TSPAN12-tetraspanin 12 Gene now

Add to cart