Login to display prices
Login to display prices
TSPAN12-tetraspanin 12 Gene View larger

TSPAN12-tetraspanin 12 Gene

PTXBC031265

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSPAN12-tetraspanin 12 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TSPAN12-tetraspanin 12 Gene

Proteogenix catalog: PTXBC031265
Ncbi symbol: TSPAN12
Product name: TSPAN12-tetraspanin 12 Gene
Size: 2ug
Accessions: BC031265
Gene id: 23554
Gene description: tetraspanin 12
Synonyms: EVR5; NET-2; NET2; TM4SF12; tetraspanin-12; tetraspan NET-2; transmembrane 4 superfamily member 12; tspan-12; tetraspanin 12
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccagagaagattccgtgaagtgtctgcgctgcctgctctacgccctcaatctgctcttttggttaatgtccatcagtgtgttggcagtttctgcttggatgagggactacctaaataatgttctcactttaactgcagaaacgagggtagaggaagcagtcatttcgacttactttcctgtggttcatccggtcatgattgctgtttgctgtttccttatcattgtggggatgttaggatattgtggaacggtgaaaagaaatctgttgcttcttgcatggtactttggaagtttgcttgtcattttctgtgtagaactggcttgtggcgtttggacatatgaacaggaacttatggttccagtacaatggtcagatatggtcactttgaaagccaggatgacaaattatggattacctagatatcggtggcttactcatgcttggaatttttttcagagagagtttaagtgctgtggagtagtatatttcactgactggttggaaatgacagagatggactggcccccagattcctgctgtgttagagaattcccaggatgttccaaacaggcccaccaggaagatctcagtgacctttatcaagagggttgtgggaagaaaatgtattcctttttgagaggaaccaaacaactgcaggtgctgaggtttctgggaatctccattggggtgacacaaatcctggccatgattctcaccattactctgctctgggctctgtattatgatagaagggagcctgggacagaccaaatgatgtccttgaagaatgacaactctcagcacctgtcatgtccctcagtagaactgttgaaaccaagcctgtcaagaatctttgaacacacatccatggcaaacagctttaatacacactttgagatggaggagttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: