Login to display prices
Login to display prices
SNX10-sorting nexin 10 Gene View larger

SNX10-sorting nexin 10 Gene

PTXBC034992

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX10-sorting nexin 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNX10-sorting nexin 10 Gene

Proteogenix catalog: PTXBC034992
Ncbi symbol: SNX10
Product name: SNX10-sorting nexin 10 Gene
Size: 2ug
Accessions: BC034992
Gene id: 29887
Gene description: sorting nexin 10
Synonyms: OPTB8; sorting nexin-10; sorting nexin 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttccggaacaacagaaagaggaatttgtaagtgtctgggttcgagatcctaggattcagaaggaggacttctggcattcttacattgactatgagatatgtattcatactaatagcatgtgttttacaatgaaaacatcctgtgtacgaagaagatatagagaattcgtgtggctgaggcagagactccaaagtaatgcgttgctggtacaactgccagaacttccatctaaaaacctgtttttcaacatgaacaatcgccagcacgtggatcagcgtcgccagggtctggaagatttcctcagaaaagtcctacagaatgcacttttgctttcagatagcagccttcacctcttcttacagagccatctgaattcagaagacattgaggcgtgtgtttctgggcagactaagtactctgtggaagaagcaattcacaagtttgccttaatgaatagacgtttccctgaagaagatgaagaaggaaaaaaagaaaatgatatagattatgattcagaaagttcatcctctgggcttggacacagtagtgatgacagcagttcacatggatgtaaagtaaatacagctccgcaggaatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: