SNX10-sorting nexin 10 Gene View larger

SNX10-sorting nexin 10 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNX10-sorting nexin 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNX10-sorting nexin 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034992
Product type: DNA & cDNA
Ncbi symbol: SNX10
Origin species: Human
Product name: SNX10-sorting nexin 10 Gene
Size: 2ug
Accessions: BC034992
Gene id: 29887
Gene description: sorting nexin 10
Synonyms: OPTB8; sorting nexin-10; sorting nexin 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttccggaacaacagaaagaggaatttgtaagtgtctgggttcgagatcctaggattcagaaggaggacttctggcattcttacattgactatgagatatgtattcatactaatagcatgtgttttacaatgaaaacatcctgtgtacgaagaagatatagagaattcgtgtggctgaggcagagactccaaagtaatgcgttgctggtacaactgccagaacttccatctaaaaacctgtttttcaacatgaacaatcgccagcacgtggatcagcgtcgccagggtctggaagatttcctcagaaaagtcctacagaatgcacttttgctttcagatagcagccttcacctcttcttacagagccatctgaattcagaagacattgaggcgtgtgtttctgggcagactaagtactctgtggaagaagcaattcacaagtttgccttaatgaatagacgtttccctgaagaagatgaagaaggaaaaaaagaaaatgatatagattatgattcagaaagttcatcctctgggcttggacacagtagtgatgacagcagttcacatggatgtaaagtaaatacagctccgcaggaatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adenylate kinase 3
- ropporin 1-like
- MAX-like protein X
- tetraspanin 14

Buy SNX10-sorting nexin 10 Gene now

Add to cart