Login to display prices
Login to display prices
MARCKSL1-MARCKS-like 1 Gene View larger

MARCKSL1-MARCKS-like 1 Gene

PTXBC007904

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MARCKSL1-MARCKS-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MARCKSL1-MARCKS-like 1 Gene

Proteogenix catalog: PTXBC007904
Ncbi symbol: MARCKSL1
Product name: MARCKSL1-MARCKS-like 1 Gene
Size: 2ug
Accessions: BC007904
Gene id: 65108
Gene description: MARCKS-like 1
Synonyms: F52; MACMARCKS; MLP; MLP1; MRP; MARCKS-related protein; MARCKS-like protein 1; mac-MARCKS; macrophage myristoylated alanine-rich C kinase substrate; MARCKS like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagccagagctccaaggctccccggggcgacgtgaccgccgaggaggcagcaggcgcttcccccgcgaaggccaacggccaggagaatggccacgtgaaaagcaatggagacttatcccccaagggtgaaggggagtcgccccctgtgaacggaacagatgaggcagccggggccactggcgatgccatcgagccagcaccccctagccagggtgctgaggccaagggggaggtcccccccaaggagacccccaagaagaagaagaaattctctttcaagaagcctttcaaattgagcggcctgtccttcaagagaaatcggaaggagggtgggggtgattcttctgcctcctcacccacagaggaagagcaggagcagggggagatcggtgcctgcagcgacgagggcactgctcaggaagggaaggccgcagccacccctgagagccaggaaccccaggccaagggggcagaggctagtgcagcctcagaagaagaggcagggccccaggctacagagccatccactccctcggggccggagagtggccctacaccagccagcgctgagcagaatgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice