Login to display prices
Login to display prices
NKIRAS1-NFKB inhibitor interacting Ras-like 1 Gene View larger

NKIRAS1-NFKB inhibitor interacting Ras-like 1 Gene

PTXBC012145

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NKIRAS1-NFKB inhibitor interacting Ras-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NKIRAS1-NFKB inhibitor interacting Ras-like 1 Gene

Proteogenix catalog: PTXBC012145
Ncbi symbol: NKIRAS1
Product name: NKIRAS1-NFKB inhibitor interacting Ras-like 1 Gene
Size: 2ug
Accessions: BC012145
Gene id: 28512
Gene description: NFKB inhibitor interacting Ras-like 1
Synonyms: KBRAS1; kappaB-Ras1; NF-kappa-B inhibitor-interacting Ras-like protein 1; I-kappa-B-interacting Ras-like protein 1; NFKB inhibitor interacting Ras-like protein 1; kappa B-Ras protein 1; kappa B-ras 1; NFKB inhibitor interacting Ras like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaagggctgcaaggttgtggtttgtggattgttatctgtggggaaaactgcaattttggagcagctcctttatggaaatcatactattggaatggaagattgcgaaacaatggaagatgtatacatggcttcagtagaaacagaccgaggagtaaaagaacagttacatctttatgacaccagaggtctacaggaaggcgtggagctgccaaagcattatttttcatttgctgatggcttcgttcttgtgtacagtgtgaataaccttgaatcctttcaaagagtggagcttctgaagaaagaaatcgataagttcaaagacaaaaaagaggtagcaattgtggtattaggaaacaaaatcgacctttctgagcagagacaagtggacgctgaagtggcacagcagtgggcaaaaagtgagaaagtaagactgtgggaggtgactgttacagatcggaaaactctgattgaaccattcactttattagccagtaaactttctcaaccccagagcaaatcaagctttcctttgcctgggaggaaaaacaaagggaactctaattctgagaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice