SNAP25-synaptosomal-associated protein, 25kDa Gene View larger

SNAP25-synaptosomal-associated protein, 25kDa Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNAP25-synaptosomal-associated protein, 25kDa Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SNAP25-synaptosomal-associated protein, 25kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010647
Product type: DNA & cDNA
Ncbi symbol: SNAP25
Origin species: Human
Product name: SNAP25-synaptosomal-associated protein, 25kDa Gene
Size: 2ug
Accessions: BC010647
Gene id: 6616
Gene description: synaptosomal-associated protein, 25kDa
Synonyms: CMS18; RIC-4; RIC4; SEC9; SNAP-25; SUP; bA416N4.2; dJ1068F16.2; synaptosomal-associated protein 25; resistance to inhibitors of cholinesterase 4 homolog; synaptosomal-associated protein, 25kDa; synaptosome associated protein 25kDa; synaptosome associated protein 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgaagacgcagacatgcgcaatgagctggaggagatgcagcgaagggctgaccagttggctgatgagtcgctggaaagcacccgtcgtatgctgcaactggttgaagagagtaaagatgctggtatcaggactttggttatgttggatgaacaaggagaacaactcgatcgtgtcgaagaaggcatgaaccatatcaaccaagacatgaaggaggctgagaaaaatttaaaagatttagggaaatgctgtggccttttcatatgtccttgtaacaagcttaaatcaagtgatgcttacaaaaaagcctggggcaataatcaggacggagtggtggccagccagcctgctcgtgtagtggacgaacgggagcagatggccatcagtggcggcttcatccgcagggtaacaaatgatgcccgagaaaatgaaatggatgaaaacctagagcaggtgagcggcatcatcgggaacctccgtcacatggccctggatatgggcaatgagatcgatacacagaatcgccagatcgacaggatcatggagaaggctgattccaacaaaaccagaattgatgaggccaaccaacgtgcaacaaagatgctgggaagtggttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - synaptosomal-associated protein, 23kDa
- heparan sulfate 2-O-sulfotransferase 1
- mRNA turnover 4 homolog (S. cerevisiae)
- peroxisomal biogenesis factor 11 gamma

Buy SNAP25-synaptosomal-associated protein, 25kDa Gene now

Add to cart