HS2ST1-heparan sulfate 2-O-sulfotransferase 1 Gene View larger

HS2ST1-heparan sulfate 2-O-sulfotransferase 1 Gene

PTXBC025384

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HS2ST1-heparan sulfate 2-O-sulfotransferase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HS2ST1-heparan sulfate 2-O-sulfotransferase 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025384
Product type: DNA & cDNA
Ncbi symbol: HS2ST1
Origin species: Human
Product name: HS2ST1-heparan sulfate 2-O-sulfotransferase 1 Gene
Size: 2ug
Accessions: BC025384
Gene id: 9653
Gene description: heparan sulfate 2-O-sulfotransferase 1
Synonyms: dJ604K5.2; heparan sulfate 2-O-sulfotransferase 1; 2-O-sulfotransferase; 2OST
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctcctcaggattatgatgccgcccaagttgcagctgctggcggtggtggccttcgcggtggcgatgctcttcttggaaaaccagatccagaaactggaggagtcccgctcgaagctagaaagggctattgcaagacacgaagtccgagaaattgagcagcgacatacaatggatggccctcggcaagatgccactttagatgaggaagaggacatggtgatcatttataacagagttcccaaaacggcaagcacttcatttaccaatatcgcctatgacctgtgtgcaaagaataaataccatgtccttcatatcaacactaccaaaaataatccagtgatgtcattgcaagatcaggtgcgctttgtaaagaatataacttcctggaaagagatgaaaccaggattttatcatggacacgtttcttacttggattttgcaaaatttggtgtgaagaagaaaccaatttacattaatgtcataagggatcctattgagaggctagtttcttattattactttctgagatttggagatgattatagaccagggttacggagacgaaaacaaggagacaaaaagacctttgatgaatgtgtagcagaaggtggctcagactgtgctccagagaagctctggcttcaaatcccgttcttctgtggccatagctccgaatgctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mRNA turnover 4 homolog (S. cerevisiae)
- peroxisomal biogenesis factor 11 gamma
- splicing factor, arginine/serine-rich 1
- transmembrane and coiled-coil domains 6

Buy HS2ST1-heparan sulfate 2-O-sulfotransferase 1 Gene now

Add to cart