TMCO6-transmembrane and coiled-coil domains 6 Gene View larger

TMCO6-transmembrane and coiled-coil domains 6 Gene

PTXBC009618

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMCO6-transmembrane and coiled-coil domains 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMCO6-transmembrane and coiled-coil domains 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009618
Product type: DNA & cDNA
Ncbi symbol: TMCO6
Origin species: Human
Product name: TMCO6-transmembrane and coiled-coil domains 6 Gene
Size: 2ug
Accessions: BC009618
Gene id: 55374
Gene description: transmembrane and coiled-coil domains 6
Synonyms: PRO1580; transmembrane and coiled-coil domain-containing protein 6; transmembrane and coiled-coil domains 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctacaaatgttgcaacctggcccaaagctcaaccctggggtcgctgtggagtttgcctggtgccttcattacatcatctgcagccaggtcagcaatcctctgctcattggccatggggctctgtctactctggggttgctgctgttggacttggctggggctgtccagaaaaccgaggatgcaggactggagctgctggcatgccccgtgcttcgatgtctaagcaacctgctaactgaggcagcagtggagactgtgggagggcaaatgcagctcagagatgagcgtgttgtggcagccttatttatccttctgcagttctttttccagaaacagcccagtctgctccctgagggcctttggctcctcaacaacctcactgcaaacagtcctagtttctgtacctccttgctctccctggatctgattgagcctctcttacagctgttgccagtatctaacgtggtgagcgtaatggtgctcacagttctgtgcaatgttgcagaaaagggtcctgcttactgccagcggctgtggccagggcccctgcttcccgccttgctgcacacactagccttttctgacactgaagtagtaggccagagtttggagctgctgcatctgctgttcctgtatcagccagaggctgttcaggtcttcctgcagcagtcagggctgcaagccctggaaaggcatcaggaagaggcccagctccaggatcgtgtgtatgctctccagcagacagctcttcaagggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and SOCS box-containing 8
- inositol(myo)-1(or 4)-monophosphatase 2
- F-box and WD repeat domain containing 4
- ankyrin repeat and SOCS box-containing 9

Buy TMCO6-transmembrane and coiled-coil domains 6 Gene now

Add to cart