Login to display prices
Login to display prices
IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene View larger

IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene

PTXBC017176

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene

Proteogenix catalog: PTXBC017176
Ncbi symbol: IMPA2
Product name: IMPA2-inositol(myo)-1(or 4)-monophosphatase 2 Gene
Size: 2ug
Accessions: BC017176
Gene id: 3613
Gene description: inositol(myo)-1(or 4)-monophosphatase 2
Synonyms: inositol monophosphatase 2; IMP 2; IMPase 2; inosine monophosphatase 2; inositol monophosphatase 2 variant 1; inositol monophosphatase 2 variant 2; inositol(myo)-1(or 4)-monophosphatase 2; myo-inositol monophosphatase 2; myo-inositol monophosphatase A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagccgagcggcgaggaccaggcggcgctggcggccggcccctgggaggagtgcttccaggcggccgtgcagctggcgctgcgggcaggacagatcatcagaaaagcccttactgaggaaaaacgtgtctcaacaaaaacatcagctgcagatcttgtgacagaaacagatcaccttgtggaagatttaattatttctgagttgcgagagaggtttccttcacacaggttcattgcagaagaggccgcggcttctggggccaagtgtgtgctcacccacagcccgacgtggatcatcgaccccatcgacggcacctgcaattttgtgcacagattcccgactgtggcggttagcattggatttgctgttcgacaagagcttgaattcggagtgatttaccactgcacagaggagcggctgtacacgggccggcggggtcggggcgccttctgcaatggccagcggctccgggtctccggggagacagatctctcaaaggccttggttctgacagaaattggccccaaacgtgaccctgcgaccctgaagctgttcctgagtaacatggagcggctgctgcatgccaaggcgcatggggtccgagtgattggaagctccacattggcactctgccacctggcctcaggggccgcggatgcctattaccagtttggcctgcactgctgggatctggcggctgccacagtcatcatcagagaagcaggcggcatcgtgatagacacttcgggtggacccctcgacctcatggcttgcagagtggttgcggccagcacccgggagatggcgatgctcatagctcaggccttacagacgattaactatgggcgggatgatgagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: