Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SFRS1-splicing factor, arginine/serine-rich 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SFRS1-splicing factor, arginine/serine-rich 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010264 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SFRS1 |
| Origin species: | Human |
| Product name: | SFRS1-splicing factor, arginine/serine-rich 1 Gene |
| Size: | 2ug |
| Accessions: | BC010264 |
| Gene id: | 6426 |
| Gene description: | splicing factor, arginine/serine-rich 1 |
| Synonyms: | SFRS1; ASF; SF2; SF2p33; SRp30a; serine/arginine-rich splicing factor 1; SR splicing factor 1; alternative-splicing factor 1; pre-mRNA-splicing factor SF2, P33 subunit; splicing factor 2; splicing factor, arginine/serine-rich, 30-KD, A; serine and arginine rich splicing factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgggaggtggtgtgattcgtggccccgcagggaacaacgattgccgcatctacgtgggtaacttacctccagacatccgaaccaaggacattgaggacgtgttctacaaatacggcgctatccgcgacatcgacctcaagaatcgccgcgggggaccgcccttcgccttcgttgagttcgaggacccgcgagacgcggaagacgcggtgtatggtcgcgacggctatgattacgatgggtaccgtctgcgggtggagtttcctcgaagcggccgtggaacaggccgaggcggcggcgggggtggaggtggcggagctccccgaggtcgctatggccccccatccaggcggtctgaaaacagagtggttgtctctggactgcctccaagtggaagttggcaggatttaaaggatcacatgcgtgaagcaggtgatgtatgttatgctgatgtttaccgagatggcactggtgtcgtggagtttgtacggaaagaagatatgacctatgcagttcgaaaactggataacactaagtttagatctcatgagggagaaactgcctacatccgggttaaagttgatgggcccagaagtccaagttatggaagatctcgatctcgaagccgtagtcgtagcagaagccgtagcagaagcaacagcaggagtcgcagttactccccaaggagaagcagaggatcaccacgctattctccccgtcatagcagatctcgctctcgtacataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane and coiled-coil domains 6 - ankyrin repeat and SOCS box-containing 8 - inositol(myo)-1(or 4)-monophosphatase 2 - F-box and WD repeat domain containing 4 |