Login to display prices
Login to display prices
SFRS1-splicing factor, arginine/serine-rich 1 Gene View larger

SFRS1-splicing factor, arginine/serine-rich 1 Gene

PTXBC010264

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SFRS1-splicing factor, arginine/serine-rich 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SFRS1-splicing factor, arginine/serine-rich 1 Gene

Proteogenix catalog: PTXBC010264
Ncbi symbol: SFRS1
Product name: SFRS1-splicing factor, arginine/serine-rich 1 Gene
Size: 2ug
Accessions: BC010264
Gene id: 6426
Gene description: splicing factor, arginine/serine-rich 1
Synonyms: SFRS1; ASF; SF2; SF2p33; SRp30a; serine/arginine-rich splicing factor 1; SR splicing factor 1; alternative-splicing factor 1; pre-mRNA-splicing factor SF2, P33 subunit; splicing factor 2; splicing factor, arginine/serine-rich, 30-KD, A; serine and arginine rich splicing factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgggaggtggtgtgattcgtggccccgcagggaacaacgattgccgcatctacgtgggtaacttacctccagacatccgaaccaaggacattgaggacgtgttctacaaatacggcgctatccgcgacatcgacctcaagaatcgccgcgggggaccgcccttcgccttcgttgagttcgaggacccgcgagacgcggaagacgcggtgtatggtcgcgacggctatgattacgatgggtaccgtctgcgggtggagtttcctcgaagcggccgtggaacaggccgaggcggcggcgggggtggaggtggcggagctccccgaggtcgctatggccccccatccaggcggtctgaaaacagagtggttgtctctggactgcctccaagtggaagttggcaggatttaaaggatcacatgcgtgaagcaggtgatgtatgttatgctgatgtttaccgagatggcactggtgtcgtggagtttgtacggaaagaagatatgacctatgcagttcgaaaactggataacactaagtttagatctcatgagggagaaactgcctacatccgggttaaagttgatgggcccagaagtccaagttatggaagatctcgatctcgaagccgtagtcgtagcagaagccgtagcagaagcaacagcaggagtcgcagttactccccaaggagaagcagaggatcaccacgctattctccccgtcatagcagatctcgctctcgtacataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: