Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PEX11G-peroxisomal biogenesis factor 11 gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PEX11G-peroxisomal biogenesis factor 11 gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008780 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PEX11G |
| Origin species: | Human |
| Product name: | PEX11G-peroxisomal biogenesis factor 11 gamma Gene |
| Size: | 2ug |
| Accessions: | BC008780 |
| Gene id: | 92960 |
| Gene description: | peroxisomal biogenesis factor 11 gamma |
| Synonyms: | peroxisomal membrane protein 11C; PEX11-gamma; Pex11pgamma; peroxin Pex11p gamma; peroxin-11C; peroxisomal biogenesis factor 11C; peroxisomal biogenesis factor 11G; protein PEX11 homolog gamma; peroxisomal biogenesis factor 11 gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgtcgctgagcggcctggcgtcggcgctggagtcgtacaggggccgggaccgcctgatccgagtgctggggtactgctgccagctggttggtggagttctggttgaacagtgtcccgccaggtccgaagtggggacacgtctgttggtggtgtccacccaactcagccactgcaggaccatcttgcgactctttgatgacctggccatgtttgtctacactaagcaatatggcctgggggcacaggaggaggacgcctttgtccgctgtgtctccgtcctagggaacctggctgaccagctctactacccctgtgagcacgtggcctgggcggctgatgcccgggtcctccacgtggactcttctcggtggtggacgctgagtacaaccctgtgggccctctctctgctcctgggggttgccaggtccctgtggatgctgctgaaactgagacagaggctgcggagccccacggcgcccttcaccagcccgctgccccggggcaagcggagggccatggaggcgcagatgcagtcggaggcgctgtcacttctcagcaacctggccgacctggccaacgccgtgcactggctgccccggggcgtgctgtgggccggccgcttcccgccgtggctagtgggcctcatgggcaccatctcctcaatcctcagcatgtaccaggcggcccgggccggcggccaggccgaggccactaccccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - splicing factor, arginine/serine-rich 1 - transmembrane and coiled-coil domains 6 - ankyrin repeat and SOCS box-containing 8 - inositol(myo)-1(or 4)-monophosphatase 2 |