Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of SNAP23-synaptosomal-associated protein, 23kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNAP23-synaptosomal-associated protein, 23kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000148 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNAP23 |
| Origin species: | Human |
| Product name: | SNAP23-synaptosomal-associated protein, 23kDa Gene |
| Size: | 2ug |
| Accessions: | BC000148 |
| Gene id: | 8773 |
| Gene description: | synaptosomal-associated protein, 23kDa |
| Synonyms: | HsT17016; SNAP-23; SNAP23A; SNAP23B; synaptosomal-associated protein 23; synaptosomal-associated protein, 23kD; synaptosomal-associated protein, 23kDa; synaptosome associated protein 23kDa; vesicle-membrane fusion protein SNAP-23; synaptosome associated protein 23 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggataatctgtcatcagaagaaattcaacagagagctcaccagattactgatgagtctctggaaagtacgaggagaatcctgggtttagccattgagtctcaggatgcaggaatcaagaccatcactatgctggatgaacaaaaggaacaactaaaccgcatagaagaaggcttggaccaaataaataaggacatgagagagacagagaagactttaacagaactcaacaaatgctgtggcctttgtgtctgcccatgtaatagaacaaagaactttgagtctggcaaggcttataagacaacatggggagatggtggagaaaactcaccttgcaatgtagtatctaaacagccaggcccggtgacaaatggtcagcttcagcaaccaacaacaggagcagccagtggtggatacattaaacgcataactaatgatgccagagaagatgaaatggaagagaacctgactcaagtgggcagtatcctgggaaatctaaaagacatggccctgaacataggcaatgagattgatgctcaaaatccacaaataaaacgaatcacagacaaggctgacaccaacagagatcgtattgatattgccaatgccagagcaaagaaactcattgacagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heparan sulfate 2-O-sulfotransferase 1 - mRNA turnover 4 homolog (S. cerevisiae) - peroxisomal biogenesis factor 11 gamma - splicing factor, arginine/serine-rich 1 |