Login to display prices
Login to display prices
SNAP23-synaptosomal-associated protein, 23kDa Gene View larger

SNAP23-synaptosomal-associated protein, 23kDa Gene

PTXBC000148

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SNAP23-synaptosomal-associated protein, 23kDa Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SNAP23-synaptosomal-associated protein, 23kDa Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000148
Product type: DNA & cDNA
Ncbi symbol: SNAP23
Origin species: Human
Product name: SNAP23-synaptosomal-associated protein, 23kDa Gene
Size: 2ug
Accessions: BC000148
Gene id: 8773
Gene description: synaptosomal-associated protein, 23kDa
Synonyms: HsT17016; SNAP-23; SNAP23A; SNAP23B; synaptosomal-associated protein 23; synaptosomal-associated protein, 23kD; synaptosomal-associated protein, 23kDa; synaptosome associated protein 23kDa; vesicle-membrane fusion protein SNAP-23; synaptosome associated protein 23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggataatctgtcatcagaagaaattcaacagagagctcaccagattactgatgagtctctggaaagtacgaggagaatcctgggtttagccattgagtctcaggatgcaggaatcaagaccatcactatgctggatgaacaaaaggaacaactaaaccgcatagaagaaggcttggaccaaataaataaggacatgagagagacagagaagactttaacagaactcaacaaatgctgtggcctttgtgtctgcccatgtaatagaacaaagaactttgagtctggcaaggcttataagacaacatggggagatggtggagaaaactcaccttgcaatgtagtatctaaacagccaggcccggtgacaaatggtcagcttcagcaaccaacaacaggagcagccagtggtggatacattaaacgcataactaatgatgccagagaagatgaaatggaagagaacctgactcaagtgggcagtatcctgggaaatctaaaagacatggccctgaacataggcaatgagattgatgctcaaaatccacaaataaaacgaatcacagacaaggctgacaccaacagagatcgtattgatattgccaatgccagagcaaagaaactcattgacagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heparan sulfate 2-O-sulfotransferase 1
- mRNA turnover 4 homolog (S. cerevisiae)
- peroxisomal biogenesis factor 11 gamma
- splicing factor, arginine/serine-rich 1