Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DDIT4L-DNA-damage-inducible transcript 4-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DDIT4L-DNA-damage-inducible transcript 4-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013592 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DDIT4L |
| Origin species: | Human |
| Product name: | DDIT4L-DNA-damage-inducible transcript 4-like Gene |
| Size: | 2ug |
| Accessions: | BC013592 |
| Gene id: | 115265 |
| Gene description: | DNA-damage-inducible transcript 4-like |
| Synonyms: | REDD2; Rtp801L; DNA damage-inducible transcript 4-like protein; HIF-1 responsive protein RTP801-like; REDD-2; homolog of mouse SMHS1; protein regulated in development and DNA damage response 2; regulated in development and DNA damage response 2; DNA damage inducible transcript 4 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttgcaactggcagtttgagcagcaagaacccggccagcatttcagaattgctggactgtggctatcacccagagagcctgctaagtgattttgactactgggattatgttgttcctgaacccaacctcaacgaggtaatatttgaggaatcaacttgccagaatttggttaaaatgctggagaactgtctgtccaaatcaaagcaaactaaacttggttgctcaaaggtccttgtccctgagaaactgacccagagaattgctcaagatgtcctgcggctttcctcaacggagccctgcggcttgcgaggttgtgttatgcacgtgaacttggaaattgaaaatgtatgtaaaaagctggataggattgtgtgtgattctagcgtcgtacctacttttgagcttacacttgtgtttaagcaggagaactgctcatggactagcttcagggactttttctttagtagaggtcgcttctcctctggtttcaggagaactctgatcctcagctcaggatttcgacttgttaagaaaaaactttactcactgattggaacaacagtgattgaagggtcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synaptosomal-associated protein, 25kDa - synaptosomal-associated protein, 23kDa - heparan sulfate 2-O-sulfotransferase 1 - mRNA turnover 4 homolog (S. cerevisiae) |