Login to display prices
Login to display prices
CYHR1-cysteine/histidine-rich 1 Gene View larger

CYHR1-cysteine/histidine-rich 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYHR1-cysteine/histidine-rich 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYHR1-cysteine/histidine-rich 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005073
Product type: DNA & cDNA
Ncbi symbol: CYHR1
Origin species: Human
Product name: CYHR1-cysteine/histidine-rich 1 Gene
Size: 2ug
Accessions: BC005073
Gene id: 50626
Gene description: cysteine/histidine-rich 1
Synonyms: CHRP; cysteine and histidine-rich protein 1; cysteine and histidine rich protein; cysteine/histidine-rich 1; cysteine and histidine rich 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccccaagccgggggccgagtggagcacagccctgtcccatctggtgctgggagtggtgtctctgcacgcagccgtgagcacagccgaggcaagtcgaggggctgctgctggcttcctgctccaggtcttggctgccaccaccacgctggccccagggctgagcacacatgaagactgccttgctggagcctgggtggccaccgtcatcggccttccccttctggccttcgatttccactgggtgaatggggaccgctcctctgccaacctgctcctgggaggaggcatggtgctggcagtggctggcggccacctcggccctgagggccgctctgtggctggtcaggcaatgctgttggtggtcgcagtgaccatcctcattgtagctgtcttcacggccaacacttatgggatgtgggggggggcgatgctgggtgtggcaggcctcctgagccggctggaggaggacaggctgctgctgctaccgaaggaggatgtctgtcgctgggccttggctgtaggcagctgggcttactgccgggccctgcatacacagcgcctccagtgggagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - high-mobility group box 2
- COMM domain containing 9
- peptidylprolyl isomerase F
- transmembrane protein 61