Login to display prices
Login to display prices
PPIF-peptidylprolyl isomerase F Gene View larger

PPIF-peptidylprolyl isomerase F Gene

PTXBC005020

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPIF-peptidylprolyl isomerase F Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPIF-peptidylprolyl isomerase F Gene

Proteogenix catalog: PTXBC005020
Ncbi symbol: PPIF
Product name: PPIF-peptidylprolyl isomerase F Gene
Size: 2ug
Accessions: BC005020
Gene id: 10105
Gene description: peptidylprolyl isomerase F
Synonyms: CYP3; CyP-M; Cyp-D; CypD; peptidyl-prolyl cis-trans isomerase F, mitochondrial; PPIase F; cyclophilin 3; cyclophilin D; cyclophilin F; mitochondrial cyclophilin; peptidyl-prolyl cis-trans isomerase, mitochondrial; rotamase F; peptidylprolyl isomerase F
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcgctgcgctgcggctcccgctggctcggcctgctctccgtcccgcgctccgtgccgctgcgcctccccgcggcccgcgcctgcagcaagggctccggcgacccgtcctcttcctcctcctccgggaacccgctcgtgtacctggacgtggacgccaacgggaagccgctcggccgcgtggtgctggagctgaaggcagatgtcgtcccaaagacagctgagaacttcagagccctgtgcactggtgagaagggcttcggctacaaaggctccaccttccacagggtgatcccttccttcatgtgccaggcgggcgacttcaccaaccacaatggcacaggcgggaagtccatctacggaagccgctttcctgacgagaactttacactgaagcacgtggggccaggtgtcctgtccatggctaatgctggtcctaacaccaacggctcccagttcttcatctgcaccataaagacagactggttggatggcaagcatgttgtgttcggtcacgtcaaagagggcatggacgtcgtgaagaaaatagaatctttcggctctaagagtgggaggacatccaagaagattgtcatcacagactgtggccagttgagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: