AK3L1-adenylate kinase 3-like 1 Gene View larger

AK3L1-adenylate kinase 3-like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AK3L1-adenylate kinase 3-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AK3L1-adenylate kinase 3-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC040224
Product type: DNA & cDNA
Ncbi symbol: AK3L1
Origin species: Human
Product name: AK3L1-adenylate kinase 3-like 1 Gene
Size: 2ug
Accessions: BC040224
Gene id: 205
Gene description: adenylate kinase 3-like 1
Synonyms: AK3L1; AK 4; AK3; AK3L2; adenylate kinase 4, mitochondrial; ATP-AMP transphosphorylase; GTP:AMP phosphotransferase AK4, mitochondrial; adenylate kinase 3-like 1; adenylate kinase isoenzyme 4, mitochondrial; mitochondrial adenylate kinase-3; nucleoside-triphosphate-adenylate kinase; adenylate kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccaaactcctgcgcgcggtcatcctcgggccgcccggctcgggcaagggcaccgtgagccagaggatcgcccagaactttggtctccagcatctctccagcggccacttcttgcgggagaacatcaaggccagcaccgaagttggtgagatggcaaagcagtatatagagaaaagtcttttggttccagaccatgtgatcacacgcctaatgatgtccgagttggagaacaggcgtggccagcactggctccttgatggttttcctaggacattaggacaagccgaagccctggacaaaatctgtgaagtggatctagtgatcagtttgaatattccatttgaaacacttaaagatcgtctcagccgccgttggattcaccctcctagcggaagggtatataacctggacttcaatccacctcatgtacatggtattgatgacgtcactggtgaaccgttagtccagcaggaggatgataaacccgaagcagttgctgccaggctaagacagtacaaagacgtggcaaagccagtcattgaattatacaagagccgaggagtgctccaccaattttccggaacggagacgaacaaaatctggccctacgtttacacacttttctcaaacaagatcacacctattcagtccaaagaagcatattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin kappa locus
- prolyl endopeptidase-like
- OCIA domain containing 1
- sushi domain containing 3

Buy AK3L1-adenylate kinase 3-like 1 Gene now

Add to cart