Login to display prices
Login to display prices
AK3L1-adenylate kinase 3-like 1 Gene View larger

AK3L1-adenylate kinase 3-like 1 Gene

PTXBC040224

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AK3L1-adenylate kinase 3-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AK3L1-adenylate kinase 3-like 1 Gene

Proteogenix catalog: PTXBC040224
Ncbi symbol: AK3L1
Product name: AK3L1-adenylate kinase 3-like 1 Gene
Size: 2ug
Accessions: BC040224
Gene id: 205
Gene description: adenylate kinase 3-like 1
Synonyms: AK3L1; AK 4; AK3; AK3L2; adenylate kinase 4, mitochondrial; ATP-AMP transphosphorylase; GTP:AMP phosphotransferase AK4, mitochondrial; adenylate kinase 3-like 1; adenylate kinase isoenzyme 4, mitochondrial; mitochondrial adenylate kinase-3; nucleoside-triphosphate-adenylate kinase; adenylate kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttccaaactcctgcgcgcggtcatcctcgggccgcccggctcgggcaagggcaccgtgagccagaggatcgcccagaactttggtctccagcatctctccagcggccacttcttgcgggagaacatcaaggccagcaccgaagttggtgagatggcaaagcagtatatagagaaaagtcttttggttccagaccatgtgatcacacgcctaatgatgtccgagttggagaacaggcgtggccagcactggctccttgatggttttcctaggacattaggacaagccgaagccctggacaaaatctgtgaagtggatctagtgatcagtttgaatattccatttgaaacacttaaagatcgtctcagccgccgttggattcaccctcctagcggaagggtatataacctggacttcaatccacctcatgtacatggtattgatgacgtcactggtgaaccgttagtccagcaggaggatgataaacccgaagcagttgctgccaggctaagacagtacaaagacgtggcaaagccagtcattgaattatacaagagccgaggagtgctccaccaattttccggaacggagacgaacaaaatctggccctacgtttacacacttttctcaaacaagatcacacctattcagtccaaagaagcatattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: