TMEM61-transmembrane protein 61 Gene View larger

TMEM61-transmembrane protein 61 Gene

PTXBC029775

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM61-transmembrane protein 61 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM61-transmembrane protein 61 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029775
Product type: DNA & cDNA
Ncbi symbol: TMEM61
Origin species: Human
Product name: TMEM61-transmembrane protein 61 Gene
Size: 2ug
Accessions: BC029775
Gene id: 199964
Gene description: transmembrane protein 61
Synonyms: transmembrane protein 61
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgccccagatgtgtgacgggagccacttggcctccaccctccgctattgcatgacagtcagcggcacagtggttctggtggccgggacgctctgcttcgcttggtggagcgaaggggatgcaaccgcccagcctggccagctggccccacccacggagtatccggtgcctgagggccccagccccctgctcaggtccgtcagcttcgtctgctgcggtgcaggtggcctgctgctgctcattggcctgctgtggtccgtcaaggccagcatcccagggccacctcgatgggacccctatcacctctccagagacctgtactacctcactgtggagtcctcagagaaggagagctgcaggacccccaaagtggttgacatccccacttacgaggaagccgtgagcttcccagtggccgaggggcccccaacaccacctgcataccctacggaggaagccctggagccaagtggatcgagggatgccctgctcagcacccagcccgcctggcctccacccagctatgagagcatcagccttgctcttgatgccgtttctgcagagacgacaccgagtgccacacgctcctgctcaggcctggttcagactgcacggggaggaagttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mediator complex subunit 8
- adenylate kinase 3-like 1
- immunoglobulin kappa locus
- prolyl endopeptidase-like

Buy TMEM61-transmembrane protein 61 Gene now

Add to cart