HMGB2-high-mobility group box 2 Gene View larger

HMGB2-high-mobility group box 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HMGB2-high-mobility group box 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HMGB2-high-mobility group box 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000903
Product type: DNA & cDNA
Ncbi symbol: HMGB2
Origin species: Human
Product name: HMGB2-high-mobility group box 2 Gene
Size: 2ug
Accessions: BC000903
Gene id: 3148
Gene description: high-mobility group box 2
Synonyms: HMG2; high mobility group protein B2; HMG-2; high mobility group protein 2; high-mobility group (nonhistone chromosomal) protein 2; high mobility group box 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtaaaggagaccccaacaagccgcggggcaaaatgtcctcgtacgccttcttcgtgcagacctgccgggaagagcacaagaagaaacacccggactcttccgtcaatttcgcggaattctccaagaagtgttcggagagatggaagaccatgtctgcaaaggagaagtcgaagtttgaagatatggcaaaaagtgacaaagctcgctatgacagggagatgaaaaattacgttcctcccaaaggtgataagaaggggaagaaaaaggaccccaatgctcctaaaaggccaccatctgccttcttcctgttttgctctgaacatcgcccaaagatcaaaagtgaacaccctggcctatccattggggatactgcaaagaaattgggtgaaatgtggtctgagcagtcagccaaagataaacaaccatatgaacagaaagcagctaagctaaaggagaaatatgaaaaggatattgctgcatatcgtgccaagggcaaaagtgaagcaggaaagaagggccctggcaggccaacaggctcaaagaagaagaacgaaccagaagatgaggaggaggaggaggaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - COMM domain containing 9
- peptidylprolyl isomerase F
- transmembrane protein 61
- mediator complex subunit 8

Buy HMGB2-high-mobility group box 2 Gene now

Add to cart