Login to display prices
Login to display prices
COMMD9-COMM domain containing 9 Gene View larger

COMMD9-COMM domain containing 9 Gene

PTXBC010892

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COMMD9-COMM domain containing 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COMMD9-COMM domain containing 9 Gene

Proteogenix catalog: PTXBC010892
Ncbi symbol: COMMD9
Product name: COMMD9-COMM domain containing 9 Gene
Size: 2ug
Accessions: BC010892
Gene id: 29099
Gene description: COMM domain containing 9
Synonyms: HSPC166; COMM domain-containing protein 9; COMM domain containing 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccctgacagcggagcattttgcagcactccagagcctgctcaaggcctcctcgaaagatgttgtcagacagctgtgtcaagaaagcttttccagttcagcccttggcttgaaaaaactcttggatgttacatgttccagcttgtctgtgacccaggaggaggcagaggaactgctccaggctctgcaccgcctcactaggctggtggcattccgtgacctgtcctctgccgaggcaattctggctctctttccagaaaatttccaccaaaacctcaaaaacctgctgacaaagatcatcctagaacatgtgtctacttggagaaccgaagcccaggcaaatcagatctctctgccacgcctggtcgatctggactggagagtggatatcaaaacctcctcagacagcatcagccgcatggccgtccccacctgcctgctccagatgaagatccaagaagatcccagcctatgcggagacaaaccctccatctcagctgtcaccgtggagctgagcaaagaaacactggacaccatgttagatggcctgggccgcatccgagaccaactctctgccgtggccagtaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice