Login to display prices
Login to display prices
TMEM11-transmembrane protein 11 Gene View larger

TMEM11-transmembrane protein 11 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM11-transmembrane protein 11 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM11-transmembrane protein 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002819
Product type: DNA & cDNA
Ncbi symbol: TMEM11
Origin species: Human
Product name: TMEM11-transmembrane protein 11 Gene
Size: 2ug
Accessions: BC002819
Gene id: 8834
Gene description: transmembrane protein 11
Synonyms: C17orf35; PM1; PMI; transmembrane protein 11, mitochondrial; transmembrane protein 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcttggggaaggaggcgtcttggcccgggcagcagtggcggcagcgcccgagagagggtgagcttgtcggccacagactgctacattgtgcatgagatctacaatggggagaatgcccaagaccagtttgagtacgagctggagcaggccctggaagcccagtacaagtacattgtgattgagcccactcgcattggcgacgagacagcccgctggatcaccgtgggcaactgcctgcacaagacggccgtgctggcgggcaccgcctgcctcttcaccccgttggcgctgcccttagattattcccactacatttccctgcccgctggtgtgctgagcctggcctgctgcaccctctatgggatctcctggcagtttgacccttgctgcaagtaccaagtggagtacgacgcctataaactgtcgcgcctgcctctgcacacactcacctcctccaccccggtggtgctggtccggaaggacgacctgcacagaaagagactgcacaacacgatagcactggccgccctggtgtactgtgtaaagaagatttacgaactctatgccgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine/histidine-rich 1
- high-mobility group box 2
- COMM domain containing 9
- peptidylprolyl isomerase F