Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene
PTXBC002711
New product
Data sheet of CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002711 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDC42 |
| Origin species: | Human |
| Product name: | CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene |
| Size: | 2ug |
| Accessions: | BC002711 |
| Gene id: | 998 |
| Gene description: | cell division cycle 42 (GTP binding protein, 25kDa) |
| Synonyms: | small GTP binding protein CDC42; CDC42Hs; G25K; TKS; cell division control protein 42 homolog; G25K GTP-binding protein; GTP binding protein, 25kDa; dJ224A6.1.1 (cell division cycle 42 (GTP-binding protein, 25kD)); dJ224A6.1.2 (cell division cycle 42 (GTP-binding protein, 25kD)); growth-regulating protein; cell division cycle 42 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcagacaattaagtgtgttgttgtgggcgatggtgctgttggtaaaacatgtctcctgatatcctacacaacaaacaaatttccatcggaatatgtaccgactgtttttgacaactatgcagtcacagttatgattggtggagaaccatatactcttggactttttgatactgcagggcaagaggattatgacagattacgaccgctgagttatccacaaacagatgtatttctagtctgtttttcagtggtctctccatcttcatttgaaaacgtgaaagaaaagtgggtgcctgagataactcaccactgtccaaagactcctttcttgcttgttgggactcaaattgatctcagagatgacccctctactattgagaaacttgccaagaacaaacagaagcctatcactccagagactgctgaaaagctggcccgtgacctgaaggctgtcaagtatgtggagtgttctgcacttacacagaaaggcctaaagaatgtatttgacgaagcaatattggctgccctggagcctccagaaccgaagaagagccgcaggtgtgtgctgctatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - loss of heterozygosity, 12, chromosomal region 1 - hepatoma-derived growth factor, related protein 3 - vacuolar protein sorting 28 homolog (S. cerevisiae) - vacuolar protein sorting 24 homolog (S. cerevisiae) |