CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene View larger

CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002711
Product type: DNA & cDNA
Ncbi symbol: CDC42
Origin species: Human
Product name: CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene
Size: 2ug
Accessions: BC002711
Gene id: 998
Gene description: cell division cycle 42 (GTP binding protein, 25kDa)
Synonyms: small GTP binding protein CDC42; CDC42Hs; G25K; TKS; cell division control protein 42 homolog; G25K GTP-binding protein; GTP binding protein, 25kDa; dJ224A6.1.1 (cell division cycle 42 (GTP-binding protein, 25kD)); dJ224A6.1.2 (cell division cycle 42 (GTP-binding protein, 25kD)); growth-regulating protein; cell division cycle 42
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagacaattaagtgtgttgttgtgggcgatggtgctgttggtaaaacatgtctcctgatatcctacacaacaaacaaatttccatcggaatatgtaccgactgtttttgacaactatgcagtcacagttatgattggtggagaaccatatactcttggactttttgatactgcagggcaagaggattatgacagattacgaccgctgagttatccacaaacagatgtatttctagtctgtttttcagtggtctctccatcttcatttgaaaacgtgaaagaaaagtgggtgcctgagataactcaccactgtccaaagactcctttcttgcttgttgggactcaaattgatctcagagatgacccctctactattgagaaacttgccaagaacaaacagaagcctatcactccagagactgctgaaaagctggcccgtgacctgaaggctgtcaagtatgtggagtgttctgcacttacacagaaaggcctaaagaatgtatttgacgaagcaatattggctgccctggagcctccagaaccgaagaagagccgcaggtgtgtgctgctatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - loss of heterozygosity, 12, chromosomal region 1
- hepatoma-derived growth factor, related protein 3
- vacuolar protein sorting 28 homolog (S. cerevisiae)
- vacuolar protein sorting 24 homolog (S. cerevisiae)

Buy CDC42-cell division cycle 42 (GTP binding protein, 25kDa) Gene now

Add to cart