VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene View larger

VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006485
Product type: DNA & cDNA
Ncbi symbol: VPS28
Origin species: Human
Product name: VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC006485
Gene id: 51160
Gene description: vacuolar protein sorting 28 homolog (S. cerevisiae)
Synonyms: VPS28, ESCRT-I subunit; ESCRT-I complex subunit VPS28; vacuolar protein sorting-associated protein 28 homolog; vacuolar protein sorting 28 homolog; vacuolar protein sorting 28-like protein; yeast class E protein Vps28p homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtttcatgggatcccagccacgccgggcataggagcccctgggaacaagccggagctgtatgaggaagtgaagttgtacaagaacgcccgggagagggagaagtacgacaacatggcagagctgtttgcggtggtgaagacaatgcaagccctggagaaggcctacatcaaggactgtgtctcccccagcgagtacactgcagcctgctcccggctcctggtccaatacaaagctgccttcaggcaggtccagggctcagaaatcagctctattgacgaattctgccgcaagttccgcctggactgcccgctggccatggagcggatcaaggaggaccggcccatcaccatcaaggacgacaagggcaacctcaaccgctgcatcgcagacgtggtctcgctcttcatcacggtcatggacaagctgcgcctggagatccgcgccatggatgagatccagcccgacctgcgagagctgatggagaccatgcaccgcatgagccacctcccacccgactttgagggccgccagacggtcagccagtggctgcagaccctgagcggcatgtcggcgtcagatgagctggacgactcacaggtgcgtcagatgctgttcgacctggagtcagcctacaacgccttcaaccgcttcctgcatgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vacuolar protein sorting 24 homolog (S. cerevisiae)
- anterior pharynx defective 1 homolog A (C. elegans)
- anterior pharynx defective 1 homolog A (C. elegans)
- fumarylacetoacetate hydrolase domain containing 2A

Buy VPS28-vacuolar protein sorting 28 homolog (S. cerevisiae) Gene now

Add to cart