VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene View larger

VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene

PTXBC004419

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004419
Product type: DNA & cDNA
Ncbi symbol: VPS24
Origin species: Human
Product name: VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC004419
Gene id: 51652
Gene description: vacuolar protein sorting 24 homolog (S. cerevisiae)
Synonyms: VPS24; CGI-149; NEDF; charged multivesicular body protein 3; 25.1 protein; CHMP family, member 3; chromatin-modifying protein 3; neuroendocrine differentiation factor; vacuolar protein sorting 24 homolog; vacuolar protein sorting-associated protein 24
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctgtttggaaagacccaggagaagccgcccaaagaactggtcaatgagtggtcattgaagataagaaaggaaatgagagttgttgacaggcaaataagggatatccaaagagaagaagaaaaagtgaaacgatctgtgaaagatgctgccaagaagggccagaaggatgtctgcatagttctggccaaggagatgatcaggtcaaggaaggctgtgagcaagctgtatgcatccaaagcacacatgaactcagtgctcatggggatgaagaaccagctcgcggtcttgcgagtggctggttccctgcagaagagcacagaagtgatgaaggccatgcaaagtcttgtgaagattccagagattcaggccaccatgagggagttgtccaaagaaatgatgaaggctgggatcatagaggagatgttagaggacacttttgaaagcatggacgatcaggaagaaatggaggaagaagcagaaatggaaattgacagaattctctttgaaattacagcaggggccttgggcaaagcacccagtaaagtgactgatgcccttccagagccagaacctccaggagcgatggctgcctcagaggatgaggaggaggaggaagaggctctggaggccatgcagtcccggctggccacactccgcagctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - anterior pharynx defective 1 homolog A (C. elegans)
- anterior pharynx defective 1 homolog A (C. elegans)
- fumarylacetoacetate hydrolase domain containing 2A
- ubiquitin-like domain containing CTD phosphatase 1

Buy VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene now

Add to cart