Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene
PTXBC004419
New product
Data sheet of VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004419 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS24 |
| Origin species: | Human |
| Product name: | VPS24-vacuolar protein sorting 24 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC004419 |
| Gene id: | 51652 |
| Gene description: | vacuolar protein sorting 24 homolog (S. cerevisiae) |
| Synonyms: | VPS24; CGI-149; NEDF; charged multivesicular body protein 3; 25.1 protein; CHMP family, member 3; chromatin-modifying protein 3; neuroendocrine differentiation factor; vacuolar protein sorting 24 homolog; vacuolar protein sorting-associated protein 24 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggctgtttggaaagacccaggagaagccgcccaaagaactggtcaatgagtggtcattgaagataagaaaggaaatgagagttgttgacaggcaaataagggatatccaaagagaagaagaaaaagtgaaacgatctgtgaaagatgctgccaagaagggccagaaggatgtctgcatagttctggccaaggagatgatcaggtcaaggaaggctgtgagcaagctgtatgcatccaaagcacacatgaactcagtgctcatggggatgaagaaccagctcgcggtcttgcgagtggctggttccctgcagaagagcacagaagtgatgaaggccatgcaaagtcttgtgaagattccagagattcaggccaccatgagggagttgtccaaagaaatgatgaaggctgggatcatagaggagatgttagaggacacttttgaaagcatggacgatcaggaagaaatggaggaagaagcagaaatggaaattgacagaattctctttgaaattacagcaggggccttgggcaaagcacccagtaaagtgactgatgcccttccagagccagaacctccaggagcgatggctgcctcagaggatgaggaggaggaggaagaggctctggaggccatgcagtcccggctggccacactccgcagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - anterior pharynx defective 1 homolog A (C. elegans) - anterior pharynx defective 1 homolog A (C. elegans) - fumarylacetoacetate hydrolase domain containing 2A - ubiquitin-like domain containing CTD phosphatase 1 |