Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UBLCP1-ubiquitin-like domain containing CTD phosphatase 1 Gene
PTXBC013425
New product
Data sheet of UBLCP1-ubiquitin-like domain containing CTD phosphatase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UBLCP1-ubiquitin-like domain containing CTD phosphatase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013425 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UBLCP1 |
| Origin species: | Human |
| Product name: | UBLCP1-ubiquitin-like domain containing CTD phosphatase 1 Gene |
| Size: | 2ug |
| Accessions: | BC013425 |
| Gene id: | 134510 |
| Gene description: | ubiquitin-like domain containing CTD phosphatase 1 |
| Synonyms: | nuclear proteasome inhibitor UBLCP1; CPUB1; ubiquitin-like domain-containing CTD phosphatase 1; CTD phosphatase-like with ubiquitin domain 1; CTD-like phosphatase domain-containing protein; ubiquitin like domain containing CTD phosphatase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctctccctatcattgtaaaatggggtggacaggagtattcagtgaccacactttcagaagatgatactgtgctcgatctcaaacagtttctcaagacccttacaggagttcttccagaacgccaaaagttacttggactcaaagttaaaggcaaacctgcagaaaatgatgttaagcttggagctctcaaactgaaaccaaatactaaaatcatgatgatgggaactcgtgaggagagcttggaagatgtcttaggtccaccccctgacaatgatgatgttgttaatgactttgatattgaagatgaagtagttgaagtagaaaatagggaagaaaacctactgaaaatttctcgcagagtgaaagagtacaaagtggaaattttgaatcctcccagggaagggaaaaagcttttggtgctagatgttgattatacattatttgaccacaggtcttgtgcagagactggggtagaattaatgcggccatatcttcatgaatttctaacatctgcctatgaagattatgacattgttatttggtctgcaacaaatatgaagtggattgaagctaaaatgaaagagctgggagtgagcacaaatgcaaattataagattactttcatgttggatagtgctgctatgataacagtacatactccaaggagaggattaatagacgtaaagcctcttggtgttatatggggaaagttttcggagttttacagcaagaaaaacaccattatgtttgatgacatagggagaaattttctaatgaacccacagaatggactaaagataaggccttttatgaaagcgcacctaaatcgtgataaagacaaagaacttttaaaattaactcagtacctcaaggagatagcaaaattagatgactttttggatctaaatcacaaatattgggaaagatatctctcaaagaagcaaggacagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - APEX nuclease (multifunctional DNA repair enzyme) 1 - hairy/enhancer-of-split related with YRPW motif-like - vacuolar protein sorting 11 homolog (S. cerevisiae) - par-3 partitioning defective 3 homolog (C. elegans) |