Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene
PTXBC006087
New product
Data sheet of HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006087 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HEYL |
| Origin species: | Human |
| Product name: | HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene |
| Size: | 2ug |
| Accessions: | BC006087 |
| Gene id: | 26508 |
| Gene description: | hairy/enhancer-of-split related with YRPW motif-like |
| Synonyms: | HESR3; HEY3; HRT3; bHLHb33; hairy/enhancer-of-split related with YRPW motif-like protein; HEY-like protein; HRT-3; class B basic helix-loop-helix protein 33; hHRT3; hHeyL; hairy-related transcription factor 3; hairy/enhancer-of-split related with YRPW motif 3; hes related family bHLH transcription factor with YRPW motif-like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcgacccaaggagccgagcggctccgacggggagtccgacggacccatcgacgtgggccaagagggccagctgagccagatggccaggccgctgtccacccccagctcttcgcagatgcaagccaggaagaaacgcagagggatcatagagaaacggcgtcgagaccgcatcaacagtagcctttctgaattgcgacgcttggtccccactgcctttgagaaacagggctcttccaagctggagaaagccgaggtcttgcagatgacggtggatcacttgaaaatgctccatgccactggtgggacaggattctttgatgcccgagccctggcagttgacttccggagcattggttttcgggagtgcctcactgaggtcatcaggtacctgggggtccttgaagggcccagcagccgtgcagaccccgtccggattcgccttctctcccacctcaacagctacgcagccgagatggagccttcgcccacgcccactggccctttggccttccctgcctggccctggtctttcttccatagctgtccagggctgccagccctgagcaaccagctcgccatcctgggaagagtgcccagccctgtcctccccggtgtctcctctcctgcttaccccatcccagccctccgaaccgctccccttcgcagagccacaggcatcatcctgccagcccggaggaatgtgctgcccagtcgaggggcatcttccacccggagggcccgccccctagagaggccagcgacccctgtgcctgtcgcccccagcagcagggctgccaggagcagccacatcgctcccctcctgcagtcttcctccccaacaccccctggtcctacagggtcggctgcttacgtggctgttcccacccccaactcatcctccccagggccagctgggaggccagcgggagccatgctctaccactcctgggtctctgaaatcactgaaatcggggctttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 11 homolog (S. cerevisiae) - par-3 partitioning defective 3 homolog (C. elegans) - KTI12 homolog, chromatin associated (S. cerevisiae) - vacuolar protein sorting 72 homolog (S. cerevisiae) |