Login to display prices
Login to display prices
HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene View larger

HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene

PTXBC006087

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene

Proteogenix catalog: PTXBC006087
Ncbi symbol: HEYL
Product name: HEYL-hairy/enhancer-of-split related with YRPW motif-like Gene
Size: 2ug
Accessions: BC006087
Gene id: 26508
Gene description: hairy/enhancer-of-split related with YRPW motif-like
Synonyms: HESR3; HEY3; HRT3; bHLHb33; hairy/enhancer-of-split related with YRPW motif-like protein; HEY-like protein; HRT-3; class B basic helix-loop-helix protein 33; hHRT3; hHeyL; hairy-related transcription factor 3; hairy/enhancer-of-split related with YRPW motif 3; hes related family bHLH transcription factor with YRPW motif-like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcgacccaaggagccgagcggctccgacggggagtccgacggacccatcgacgtgggccaagagggccagctgagccagatggccaggccgctgtccacccccagctcttcgcagatgcaagccaggaagaaacgcagagggatcatagagaaacggcgtcgagaccgcatcaacagtagcctttctgaattgcgacgcttggtccccactgcctttgagaaacagggctcttccaagctggagaaagccgaggtcttgcagatgacggtggatcacttgaaaatgctccatgccactggtgggacaggattctttgatgcccgagccctggcagttgacttccggagcattggttttcgggagtgcctcactgaggtcatcaggtacctgggggtccttgaagggcccagcagccgtgcagaccccgtccggattcgccttctctcccacctcaacagctacgcagccgagatggagccttcgcccacgcccactggccctttggccttccctgcctggccctggtctttcttccatagctgtccagggctgccagccctgagcaaccagctcgccatcctgggaagagtgcccagccctgtcctccccggtgtctcctctcctgcttaccccatcccagccctccgaaccgctccccttcgcagagccacaggcatcatcctgccagcccggaggaatgtgctgcccagtcgaggggcatcttccacccggagggcccgccccctagagaggccagcgacccctgtgcctgtcgcccccagcagcagggctgccaggagcagccacatcgctcccctcctgcagtcttcctccccaacaccccctggtcctacagggtcggctgcttacgtggctgttcccacccccaactcatcctccccagggccagctgggaggccagcgggagccatgctctaccactcctgggtctctgaaatcactgaaatcggggctttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: