VPS11-vacuolar protein sorting 11 homolog (S. cerevisiae) Gene View larger

VPS11-vacuolar protein sorting 11 homolog (S. cerevisiae) Gene

PTXBC012051

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS11-vacuolar protein sorting 11 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VPS11-vacuolar protein sorting 11 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012051
Product type: DNA & cDNA
Ncbi symbol: VPS11
Origin species: Human
Product name: VPS11-vacuolar protein sorting 11 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012051
Gene id: 55823
Gene description: vacuolar protein sorting 11 homolog (S. cerevisiae)
Synonyms: VPS11, CORVET/HOPS core subunit; END1; HLD12; PEP5; RNF108; hVPS11; vacuolar protein sorting-associated protein 11 homolog; RING finger protein 108; vacuolar protein sorting 11 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgaagtgcagccagactcaccccaggggatctacgacacactccttgagctgcgactgcagaactgggcccacgagaaggatccacaggtcaaagagaagcttcacgcagaggccatttccctgctgaagagtggtcgcttctgtgacgtctttgacaaggccctggtcctgtgccagatgcacgacttccaggatggtgtcctttacctttatgagcaggggaagctgttccagcagatcatgcactaccacatgcagcacgagcagtaccggcaggtcatcagcgtgtgtgagcgccatggggagcaggacccctccttgtgggagcaggccctcagctacttcgctcgcaaggaggaggactgcaaggagtatgtggcagctgtcctcaagcatatcgagaacaagaacctcatgccacctcttctagtggtgcagaccctggcccacaactccacagccacactctccgtcatcagggactacctggtccaaaaactacagaaacagagccagcagattgcacaggatgagctgcgggtgcggcggtaccgagaggagaccacccgtatccgccaggagatccaagagctcaaggccagtcctaagattttccaaaagaccaagtgcagcatctgtaacagtgccttggagttgccctcagtccacttcctgtgtggccactccttccaccaacactgctttgagagttactcggaaagtgatgctgactgccccacctgcctccctgaaaaccggaaggtcatggatatgatccgggcccaggaacagaaacgagatctccatgatcaattccagcatcagctcaggtgctccaatgacagcttttctgtgattgctgactactttggcagaggtgttttcaacaaattgactctgctgaccgaccctcccacagccagactgacctccagcctggaggctgggctgcaacgcgacctactcatgcactccaggaggggcacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - par-3 partitioning defective 3 homolog (C. elegans)
- KTI12 homolog, chromatin associated (S. cerevisiae)
- vacuolar protein sorting 72 homolog (S. cerevisiae)
- glycerol-3-phosphate dehydrogenase 2 (mitochondrial)

Buy VPS11-vacuolar protein sorting 11 homolog (S. cerevisiae) Gene now

Add to cart