KTI12-KTI12 homolog, chromatin associated (S. cerevisiae) Gene View larger

KTI12-KTI12 homolog, chromatin associated (S. cerevisiae) Gene

PTXBC012173

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KTI12-KTI12 homolog, chromatin associated (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KTI12-KTI12 homolog, chromatin associated (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012173
Product type: DNA & cDNA
Ncbi symbol: KTI12
Origin species: Human
Product name: KTI12-KTI12 homolog, chromatin associated (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012173
Gene id: 112970
Gene description: KTI12 homolog, chromatin associated (S. cerevisiae)
Synonyms: KTI12 chromatin associated homolog; KTI12 homolog, chromatin associated; protein KTI12 homolog; SBBI81
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgctcgtggtgttttgcgggctgccgtacagcggcaagagccggcgtgctgaagagttgcgcgtggcgctggctgccgagggccgcgcggtgtacgtggtggacgacgcagctgtcctgggcgcagaggacccagcggtgtacggcgattctgcccgtgagaaggcattgcgtggagctctgcgagcctccgtggaacggcgcctgagtcgccacgacgtggtcatcctggactcgcttaactacatcaaaggtttccgttacgagctctactgcctggcacgggcggcgcgcaccccgctctgcctggtctactgcgtacggcccggcggcccgatcgcgggacctcaggtggcgggcgcgaacgagaaccctggccggaacgtcagtgtgagttggcggccacgcgctgaggaggacgggagagcccaggcggcgggcagcagcgtcctcagggaactgcatactgcggactctgtagtaaatggaagtgcccaggccgacgtacccaaggaactggagcgagaagaatccggggctgcggagtctccagctcttgtgactccggattcagagaaatctgcaaagcatgggtccggtgccttttactctcccgaactcctggaggccctaacgctgcgctttgaggctcccgattctcggaatcgctgggaccggcctttattcactttggtgggcctagaggagccgttgcccctggcggggatccgctctgccctgtttgagaaccgggccccaccaccccatcagtctacgcagtcccagcccctcgcctccggcagctttctgcaccagttggaccaggtcacgagtcaagtactggccggattgatggaagcgcagaagagcgctgtccccggggacttgctcacgcttcctggtaccacagagcacttgcggtttacccggcccttgaccatggcagaactgagtcgccttcgtcgccagtttatttcgtacactaaaatgcatcccaacaatgagaacttgccgcaactggccaacatgtttcttcagtatttgagccagagcctgcactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vacuolar protein sorting 72 homolog (S. cerevisiae)
- glycerol-3-phosphate dehydrogenase 2 (mitochondrial)
- intraflagellar transport 81 homolog (Chlamydomonas)
- major facilitator superfamily domain containing 11

Buy KTI12-KTI12 homolog, chromatin associated (S. cerevisiae) Gene now

Add to cart