IFT81-intraflagellar transport 81 homolog (Chlamydomonas) Gene View larger

IFT81-intraflagellar transport 81 homolog (Chlamydomonas) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFT81-intraflagellar transport 81 homolog (Chlamydomonas) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IFT81-intraflagellar transport 81 homolog (Chlamydomonas) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004536
Product type: DNA & cDNA
Ncbi symbol: IFT81
Origin species: Human
Product name: IFT81-intraflagellar transport 81 homolog (Chlamydomonas) Gene
Size: 2ug
Accessions: BC004536
Gene id: 28981
Gene description: intraflagellar transport 81 homolog (Chlamydomonas)
Synonyms: CDV-1; CDV-1R; CDV1; CDV1R; DV1; intraflagellar transport protein 81 homolog; carnitine deficiency-associated gene expressed in ventricle 1; carnitine deficiency-associated protein expressed in ventricle 1; intraflagellar transport 81 homolog; intraflagellar transport 81
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgatcaaattaaattcattatggacagtctcaataaggagccctttaggaagaactataatttaatcacgtttgattccttggagccaatgcaactattacaagttctcagtgatgttctggctgagattgacccaaagcaacttgtggatatcagagaggagatgccagagcagacagccaaacgaatgttgagccttcttggtattcttaagtacaaaccttcaggaaatgccacagatatgagtacttttcgtcagggtttggtgattggaagtaaacctgtaatttacccagtgctccactggcttcttcagaggactaatgaactgaagaaaagagcatatttagctcgttttttaataaaacttgaggtaccaagtgagtttcttcaggatgaaactgtggctgacaccaataaacagtatgaagagttaatggaagcctttaaaactttgcataaagaatatgagcagctcaagatatctggattttctacagcagaaataagaaaggatatcagtgcaatggaagaagaaaaggatcagctcattaagagagttgaacatttgaagaaaagggttgagacagctcagaatcatcaatggatgcttaaaatagcaaggcaacttcgagttgaaaaagagagagaagaatatcttgcacaacagaaacaggaacaaaagaatcagctatttcatgcagtgcaaagattgcaaagagtacaaaaccagctgaaaagcatgcgccaagctgcagcagatgcaaagcctgaaagtttaatgaagaggctagaggaggagataaaatttaatttatatatggtaactgaaaaatttcctaaagaattagaaaataagaaaaaggaattacattttttacaaaaagtagtttcagagccagctatgggccattctgatcttcttgaacttgaatctaaaataaatgaaataaacacagaaattaaccagttgattgaaaagaaaatgatgagaaatgagcccattgaaggcaaactctcactgtataggcaacaggcatctatcatttcccgtaaaaaagaagccaaagctgaggaacttcaggaggccaaggagaagttagccagcctagagagagaagcatcagtaaagagaaatcagacccgtgaatttgatggtactgaagttttaaagggagatgagagacaggatctcactctgtcacccaggctggagtgcggtggtgtgatcatggcttactgcagcctgaaactcctaggctcaagtgatcctcctacctcagcctcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major facilitator superfamily domain containing 11
- bactericidal/permeability-increasing protein-like 1
- protein tyrosine phosphatase, non-receptor type 11
- gamma-aminobutyric acid (GABA) A receptor, gamma 1

Buy IFT81-intraflagellar transport 81 homolog (Chlamydomonas) Gene now

Add to cart