Login to display prices
Login to display prices
VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene View larger

VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene

PTXBC003151

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene

Proteogenix catalog: PTXBC003151
Ncbi symbol: VPS72
Product name: VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC003151
Gene id: 6944
Gene description: vacuolar protein sorting 72 homolog (S. cerevisiae)
Synonyms: CFL1; Swc2; TCFL1; YL-1; vacuolar protein sorting-associated protein 72 homolog; transcription factor-like 1; transformation suppressor gene YL-1; vacuolar protein sorting 72 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtttggctgggggccgggcaccccggaagaccgctgggaaccggctttctgggcttttggaggcagaggaggaagatgagttctaccagacgacttatgggggtttcacagaggaatccggagatgatgagtatcaaggggaccagtcagacacagaggacgaagtggactctgactttgacattgatgaaggggatgaaccatccagtgatggagaagcagaagagccaagaaggaagcgccgagtagtcaccaaggcctataaggaacctctcaagagcttaaggcctcgaaaggtcaacaccccggctggtagctctcagaaggcgcgagaagagaaggcactactgccattagaactacaagatgacggctctgacagtcggaagtctatgcgtcagtctacagctgagcatacacgacaaacgttccttcgggtacaggagaggcagggccagtcaagacggcgaaaggggccccactgtgagcggccactaacccaggaggaactgctccgggaggccaagatcacagaagagcttaatttacggtcactggagacatatgagcggctcgaggctgataaaaagaagcaggttcataagaagcggaagtgccccgggcccataatcacctatcattcagtgacagtgccacttgttggggagccaggccccaaggaagagaacgttgacatagaaggacttgatcctgctccctcggtgtctgcattgactcctcatgctgggactggacccgtcaacccccctgctcgctgctcacgtaccttcatcacttttagtgatgatgcaactttcgaggaatggttcccccaagggcggcccccaaaagtccctgttcgtgaggtctgtccagtgacccatcgtccagccctataccgggaccctgttacagacataccctatgccactgctcgagccttcaagatcattcgtgaggcttacaagaagtacattactgcccatggactgccgcccactgcctcagccctgggccccggcccgccacctcctgagcccctccctggctctgggccccgagccttgcgccagaaaattgtcattaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: