Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene
PTXBC013668
New product
Data sheet of LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013668 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LOH12CR1 |
| Origin species: | Human |
| Product name: | LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene |
| Size: | 2ug |
| Accessions: | BC013668 |
| Gene id: | 118426 |
| Gene description: | loss of heterozygosity, 12, chromosomal region 1 |
| Synonyms: | LOH12CR1; LOH1CR12; BLOC-1-related complex subunit 5; loss of heterozygosity 12 chromosomal region 1 protein; loss of heterozygosity, 12, chromosomal region 1; myristoylated lysosomal protein; myrlysin; BLOC-1 related complex subunit 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcagtgagcagagctccgaggccgagagccgacccaacgatctgaactcctcagtgactccttcaccagccaagcatagagccaagatggatgatattgtggttgtagctcagggctcccaggcctcacggaacgtcagcaacgatcccgatgtcatcaagttgcaagagattccaaccttccagccccttttgaaagggctattgagtggccagacttccccaacaaatgccaaattggagaaactggactctcagcaggtgttgcagctctgcctccgatatcaagatcacctgcatcagtgtgcagaggccgttgcttttgaccagaatgctttggttaaacgaatcaaagagatggatctgtctgtagaaactctgttcagcttcatgcaggagcgccagaaaagatacgccaagtatgccgagcagatccagaaagtgaacgagatgtccgccatcctccgccgcatacagatgggcatcgaccagactgtgcccctgctggacaggctcaacagcatgctgcccgagggcgagcggctggagcccttcagcatgaagcccgaccgcgagctcaggctgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hepatoma-derived growth factor, related protein 3 - vacuolar protein sorting 28 homolog (S. cerevisiae) - vacuolar protein sorting 24 homolog (S. cerevisiae) - anterior pharynx defective 1 homolog A (C. elegans) |