Login to display prices
Login to display prices
LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene View larger

LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013668
Product type: DNA & cDNA
Ncbi symbol: LOH12CR1
Origin species: Human
Product name: LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene
Size: 2ug
Accessions: BC013668
Gene id: 118426
Gene description: loss of heterozygosity, 12, chromosomal region 1
Synonyms: LOH12CR1; LOH1CR12; BLOC-1-related complex subunit 5; loss of heterozygosity 12 chromosomal region 1 protein; loss of heterozygosity, 12, chromosomal region 1; myristoylated lysosomal protein; myrlysin; BLOC-1 related complex subunit 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagtgagcagagctccgaggccgagagccgacccaacgatctgaactcctcagtgactccttcaccagccaagcatagagccaagatggatgatattgtggttgtagctcagggctcccaggcctcacggaacgtcagcaacgatcccgatgtcatcaagttgcaagagattccaaccttccagccccttttgaaagggctattgagtggccagacttccccaacaaatgccaaattggagaaactggactctcagcaggtgttgcagctctgcctccgatatcaagatcacctgcatcagtgtgcagaggccgttgcttttgaccagaatgctttggttaaacgaatcaaagagatggatctgtctgtagaaactctgttcagcttcatgcaggagcgccagaaaagatacgccaagtatgccgagcagatccagaaagtgaacgagatgtccgccatcctccgccgcatacagatgggcatcgaccagactgtgcccctgctggacaggctcaacagcatgctgcccgagggcgagcggctggagcccttcagcatgaagcccgaccgcgagctcaggctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hepatoma-derived growth factor, related protein 3
- vacuolar protein sorting 28 homolog (S. cerevisiae)
- vacuolar protein sorting 24 homolog (S. cerevisiae)
- anterior pharynx defective 1 homolog A (C. elegans)