Login to display prices
Login to display prices
LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene View larger

LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene

PTXBC013668

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene

Proteogenix catalog: PTXBC013668
Ncbi symbol: LOH12CR1
Product name: LOH12CR1-loss of heterozygosity, 12, chromosomal region 1 Gene
Size: 2ug
Accessions: BC013668
Gene id: 118426
Gene description: loss of heterozygosity, 12, chromosomal region 1
Synonyms: LOH12CR1; LOH1CR12; BLOC-1-related complex subunit 5; loss of heterozygosity 12 chromosomal region 1 protein; loss of heterozygosity, 12, chromosomal region 1; myristoylated lysosomal protein; myrlysin; BLOC-1 related complex subunit 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagtgagcagagctccgaggccgagagccgacccaacgatctgaactcctcagtgactccttcaccagccaagcatagagccaagatggatgatattgtggttgtagctcagggctcccaggcctcacggaacgtcagcaacgatcccgatgtcatcaagttgcaagagattccaaccttccagccccttttgaaagggctattgagtggccagacttccccaacaaatgccaaattggagaaactggactctcagcaggtgttgcagctctgcctccgatatcaagatcacctgcatcagtgtgcagaggccgttgcttttgaccagaatgctttggttaaacgaatcaaagagatggatctgtctgtagaaactctgttcagcttcatgcaggagcgccagaaaagatacgccaagtatgccgagcagatccagaaagtgaacgagatgtccgccatcctccgccgcatacagatgggcatcgaccagactgtgcccctgctggacaggctcaacagcatgctgcccgagggcgagcggctggagcccttcagcatgaagcccgaccgcgagctcaggctgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice