HDGFRP3-hepatoma-derived growth factor, related protein 3 Gene View larger

HDGFRP3-hepatoma-derived growth factor, related protein 3 Gene

PTXBC015483

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HDGFRP3-hepatoma-derived growth factor, related protein 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HDGFRP3-hepatoma-derived growth factor, related protein 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015483
Product type: DNA & cDNA
Ncbi symbol: HDGFRP3
Origin species: Human
Product name: HDGFRP3-hepatoma-derived growth factor, related protein 3 Gene
Size: 2ug
Accessions: BC015483
Gene id: 50810
Gene description: hepatoma-derived growth factor, related protein 3
Synonyms: CGI-142; HDGF-2; HDGF2; HRP-3; hepatoma-derived growth factor-related protein 3; hepatoma-derived growth factor 2; hepatoma-derived growth factor, related protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgcgtccgcggccccgcgagtacaaagcgggcgacctggtcttcgccaagatgaagggctacccgcactggccggcccggattgatgaactcccagagggcgctgtgaagcctccagcaaacaagtatcctatcttcttttttggcacccatgaaactgcatttctaggtcccaaagacctttttccatataaggagtacaaagacaagtttggaaagtcaaacaaacggaaaggatttaacgaaggattgtgggaaatagaaaataacccaggagtaaagtttactggctaccaggcaattcagcaacagagctcttcagaaactgagggagaaggtggaaatactgcagatgcaagcagtgaggaagaaggtgatagagtagaagaagatggaaaaggcaaaagaaagaatgaaaaagcaggctcaaaacggaaaaagtcatatacttcaaagaaatcctctaaacagtcccggaaatctccaggagatgaagatgacaaagactgcaaagaagaggaaaacaaaagcagctctgagggtggagatgcgggcaacgacacaagaaacacaacttcagacttgcagaaaaccagtgaagggacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - vacuolar protein sorting 28 homolog (S. cerevisiae)
- vacuolar protein sorting 24 homolog (S. cerevisiae)
- anterior pharynx defective 1 homolog A (C. elegans)
- anterior pharynx defective 1 homolog A (C. elegans)

Buy HDGFRP3-hepatoma-derived growth factor, related protein 3 Gene now

Add to cart