KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene View larger

KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013572
Product type: DNA & cDNA
Ncbi symbol: KRAS
Origin species: Human
Product name: KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene
Size: 2ug
Accessions: BC013572
Gene id: 3845
Gene description: v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog
Synonyms: KRAS proto-oncogene, GTPase; GTPase KRas; C-K-RAS; CFC2; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KI-RAS; KRAS1; KRAS2; NS3; RALD; RASK2; c-Ki-ras2; K-Ras 2; K-ras p21 protein; Kirsten rat sarcoma viral oncogene homolog; PR310 c-K-ras oncogene; c-Ki-ras; c-Kirsten-ras protein; cellular c-Ki-ras2 proto-oncogene; cellular transforming proto-oncogene; oncogene KRAS2; transforming protein p21; v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactgaatataaacttgtggtagttggagctggtggcgtaggcaagagtgccttgacgatacagctaattcagaatcattttgtggacgaatatgatccaacaatagaggattcctacaggaagcaagtagtaattgatggagaaacctgtctcttggatattctcgacacagcaggtcatgaggagtacagtgcaatgagggaccagtacatgaggactggggagggctttctttgtgtatttgccataaataatactaaatcatttgaagatattcaccattatagagaacaaattaaaagagttaaggactctgaagatgtacctatggtcctagtaggaaataaatgtgatttgccttctagaacagtagacacaaaacaggctcaggacttagcaagaagttatggaattccttttattgaaacatcagcaaagacaagacagggtgttgatgatgccttctatacattagttcgagaaattcgaaaacataaagaaaagatgagcaaagatggtaaaaagaagaaaaagaagtcaaagacaaagtgtgtaattatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle 42 (GTP binding protein, 25kDa)
- loss of heterozygosity, 12, chromosomal region 1
- hepatoma-derived growth factor, related protein 3
- vacuolar protein sorting 28 homolog (S. cerevisiae)

Buy KRAS-v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog Gene now

Add to cart