Login to display prices
Login to display prices
RWDD4A-RWD domain containing 4A Gene View larger

RWDD4A-RWD domain containing 4A Gene

PTXBC017472

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RWDD4A-RWD domain containing 4A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RWDD4A-RWD domain containing 4A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017472
Product type: DNA & cDNA
Ncbi symbol: RWDD4A
Origin species: Human
Product name: RWDD4A-RWD domain containing 4A Gene
Size: 2ug
Accessions: BC017472
Gene id: 201965
Gene description: RWD domain containing 4A
Synonyms: RWDD4A; FAM28A; RWD domain-containing protein 4; RWD domain containing 4A; RWD domain-containing protein 4A; family with sequence similarity 28, member A; RWD domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgccaacgaggaccaggagatggaactagaagcattacgctctatttatgaaggagatgaaagtttccgggaattaagtccagtttcttttcaatataggataggtgaaaatggtgatcccaaagccttcttaatagagatttcctggacagaaacatatccccaaacacctccaattctatctatgaacgctttttttaacaacaccatatcatcagctgtaaagcagagtatattagccaagctacaggaagcagtagaagctaatcttggaaccgctatgacctatacattgtttgaatatgccaaagacaataaagagcagttcatggagaatcacaatcccatcaattccgcaacatcgctaagcaatatcatctcaattgaaactcctaatacagccccatcaagtaagaaaaaagacaaaaaagaacaactttcaaaagcccagaagcgtaagctggcagacaaaacagatcacaaaggagaacttcctcgaggctggaactgggttgatgttgtgaagcatttaagcaaaactggctctaaggatgatgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 11
- cysteine/histidine-rich 1
- high-mobility group box 2
- COMM domain containing 9