Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RWDD4A-RWD domain containing 4A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RWDD4A-RWD domain containing 4A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017472 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RWDD4A |
| Origin species: | Human |
| Product name: | RWDD4A-RWD domain containing 4A Gene |
| Size: | 2ug |
| Accessions: | BC017472 |
| Gene id: | 201965 |
| Gene description: | RWD domain containing 4A |
| Synonyms: | RWDD4A; FAM28A; RWD domain-containing protein 4; RWD domain containing 4A; RWD domain-containing protein 4A; family with sequence similarity 28, member A; RWD domain containing 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgccaacgaggaccaggagatggaactagaagcattacgctctatttatgaaggagatgaaagtttccgggaattaagtccagtttcttttcaatataggataggtgaaaatggtgatcccaaagccttcttaatagagatttcctggacagaaacatatccccaaacacctccaattctatctatgaacgctttttttaacaacaccatatcatcagctgtaaagcagagtatattagccaagctacaggaagcagtagaagctaatcttggaaccgctatgacctatacattgtttgaatatgccaaagacaataaagagcagttcatggagaatcacaatcccatcaattccgcaacatcgctaagcaatatcatctcaattgaaactcctaatacagccccatcaagtaagaaaaaagacaaaaaagaacaactttcaaaagcccagaagcgtaagctggcagacaaaacagatcacaaaggagaacttcctcgaggctggaactgggttgatgttgtgaagcatttaagcaaaactggctctaaggatgatgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transmembrane protein 11 - cysteine/histidine-rich 1 - high-mobility group box 2 - COMM domain containing 9 |