Login to display prices
Login to display prices
MGC16385-hypothetical protein MGC16385 Gene View larger

MGC16385-hypothetical protein MGC16385 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC16385-hypothetical protein MGC16385 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC16385-hypothetical protein MGC16385 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009263
Product type: DNA & cDNA
Ncbi symbol: MGC16385
Origin species: Human
Product name: MGC16385-hypothetical protein MGC16385 Gene
Size: 2ug
Accessions: BC009263
Gene id: 92806
Gene description: hypothetical protein MGC16385
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctggggaaaggcccacagatgcaactgtcatccctagtgccaaaagggaacggaaagcgattacccttgacctcaaattggaagtgttacgacgatttgaagcgggtgagaagctcagtcagatcgcaaaggccttagatcttgctatctctacagtggcgaccattcgagatagtaaagaaaaaatcaaagcgagttcacaaatagctactcctctgagagcctctcggttgactcgccatcgaagtgcagtgatggagagcatggagcagctgctgagcttgtggctggaagaccagagccagccaaatgcgaccttgagcgccgccatcgttcaggagaaggctgagtttgatgacttacagcgtgaacatggcgaaggttctcaaacggagaggtttcatgcaagtcaagggtggcttgtgagattcaaggagtgccactgtttgccccacttcaagatgaacagcgcagctcccagcaacaaggacatgtacatagaaatgctgaaaagcatcatcgaagaaggtgagtacaccccccaggtgtctttaacgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interleukin 6 (interferon, beta 2)
- gypsy retrotransposon integrase 1
- hypothetical protein FLJ22662
- hypothetical protein FLJ25770