IL6-interleukin 6 (interferon, beta 2) Gene View larger

IL6-interleukin 6 (interferon, beta 2) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IL6-interleukin 6 (interferon, beta 2) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about IL6-interleukin 6 (interferon, beta 2) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015511
Product type: DNA & cDNA
Ncbi symbol: IL6
Origin species: Human
Product name: IL6-interleukin 6 (interferon, beta 2) Gene
Size: 2ug
Accessions: BC015511
Gene id: 3569
Gene description: interleukin 6 (interferon, beta 2)
Synonyms: BSF-2; BSF2; CDF; HGF; HSF; IFN-beta-2; IFNB2; interleukin-6; B-cell differentiation factor; B-cell stimulatory factor 2; CTL differentiation factor; hybridoma growth factor; interferon beta-2; interleukin BSF-2; interleukin 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaactccttctccacaagcgccttcggtccagttgccttctccctggggctgctcctggtgttgcctgctgccttccctgccccagtacccccaggagaagattccaaagatgtagccgccccacacagacagccactcacctcttcagaacgaattgacaaacaaattcggtacatcctcgacggcatctcagccctgagaaaggagacatgtaacaagagtaacatgtgtgaaagcagcaaagaggcactggcagaaaacaacctgaaccttccaaagatggctgaaaaagatggatgcttccaatctggattcaatgaggagacttgcctggtgaaaatcatcactggtcttttggagtttgaggtatacctagagtacctccagaacagatttgagagtagtgaggaacaagccagagctgtgcagatgagtacaaaagtcctgatccagttcctgcagaaaaaggcaaagaatctagatgcaataaccacccctgacccaaccacaaatgccagcctgctgacgaagctgcaggcacagaaccagtggctgcaggacatgacaactcatctcattctgcgcagctttaaggagttcctgcagtccagcctgagggctcttcggcaaatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gypsy retrotransposon integrase 1
- hypothetical protein FLJ22662
- hypothetical protein FLJ25770
- mitochondrial tumor suppressor 1

Buy IL6-interleukin 6 (interferon, beta 2) Gene now

Add to cart