Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL6-interleukin 6 (interferon, beta 2) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL6-interleukin 6 (interferon, beta 2) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015511 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL6 |
| Origin species: | Human |
| Product name: | IL6-interleukin 6 (interferon, beta 2) Gene |
| Size: | 2ug |
| Accessions: | BC015511 |
| Gene id: | 3569 |
| Gene description: | interleukin 6 (interferon, beta 2) |
| Synonyms: | BSF-2; BSF2; CDF; HGF; HSF; IFN-beta-2; IFNB2; interleukin-6; B-cell differentiation factor; B-cell stimulatory factor 2; CTL differentiation factor; hybridoma growth factor; interferon beta-2; interleukin BSF-2; interleukin 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaactccttctccacaagcgccttcggtccagttgccttctccctggggctgctcctggtgttgcctgctgccttccctgccccagtacccccaggagaagattccaaagatgtagccgccccacacagacagccactcacctcttcagaacgaattgacaaacaaattcggtacatcctcgacggcatctcagccctgagaaaggagacatgtaacaagagtaacatgtgtgaaagcagcaaagaggcactggcagaaaacaacctgaaccttccaaagatggctgaaaaagatggatgcttccaatctggattcaatgaggagacttgcctggtgaaaatcatcactggtcttttggagtttgaggtatacctagagtacctccagaacagatttgagagtagtgaggaacaagccagagctgtgcagatgagtacaaaagtcctgatccagttcctgcagaaaaaggcaaagaatctagatgcaataaccacccctgacccaaccacaaatgccagcctgctgacgaagctgcaggcacagaaccagtggctgcaggacatgacaactcatctcattctgcgcagctttaaggagttcctgcagtccagcctgagggctcttcggcaaatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gypsy retrotransposon integrase 1 - hypothetical protein FLJ22662 - hypothetical protein FLJ25770 - mitochondrial tumor suppressor 1 |