Login to display prices
Login to display prices
GIN1-gypsy retrotransposon integrase 1 Gene View larger

GIN1-gypsy retrotransposon integrase 1 Gene

PTXBC015325

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GIN1-gypsy retrotransposon integrase 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GIN1-gypsy retrotransposon integrase 1 Gene

Proteogenix catalog: PTXBC015325
Ncbi symbol: GIN1
Product name: GIN1-gypsy retrotransposon integrase 1 Gene
Size: 2ug
Accessions: BC015325
Gene id: 54826
Gene description: gypsy retrotransposon integrase 1
Synonyms: GIN-1; TGIN1; ZH2C2; gypsy retrotransposon integrase-like protein 1; Ty3/Gypsy integrase 1; zinc finger H2C2 domain-containing protein; gypsy retrotransposon integrase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtccgtagtggaaaaaatggtgaccttcatcttaaacagattgcatattacaaacgaacttgtgaatatcattcaactacactgccaagtgagagaagtggcataagaagagcagcaaaaaaatttgtcttcaaagaaaaaaagctgttttatgttggaaaagacagaaaacaaaatcgtttggtaattgtttcagaagaggaaaaaaagaaagtcttaagagaatgccatgaaaatgacagtggagctcatcatggtatatccaggaccctcactctggtagaatccaattattattggacatctgtgaccaatgatgtcaaacagtgggtatatgcttgtcagcattgccaagtggcaaaaaatacagttattgtagcaccgaaacagcaccttctcaaggtggaaaatccatggagtttagttactgttgatctgatggggccttttcatacaagcaacagaagtcatgtatatgctataatcatgacagatttattcaccaaatggattgtgattttgcctctatgtgatgtttcagcatcagaagtttctaaagctattatcaatatatttttcttatatggacctcctcagaaaataataatggaccaaagagatgaattcattcaacagaaagtctttatctcttgcaaggttcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: