BDNF-brain-derived neurotrophic factor Gene View larger

BDNF-brain-derived neurotrophic factor Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BDNF-brain-derived neurotrophic factor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BDNF-brain-derived neurotrophic factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029795
Product type: DNA & cDNA
Ncbi symbol: BDNF
Origin species: Human
Product name: BDNF-brain-derived neurotrophic factor Gene
Size: 2ug
Accessions: BC029795
Gene id: 627
Gene description: brain-derived neurotrophic factor
Synonyms: ANON2; BULN2; brain-derived neurotrophic factor; abrineurin; neurotrophin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccatccttttccttactatggttatttcatactttggttgcatgaaggctgcccccatgaaagaagcaaacatccgaggacaaggtggcttggcctacccaggtgtgcggacccatgggactctggagagcgtgaatgggcccaaggcaggttcaagaggcttgacatcattggctgacactttcgaacacatgatagaagagctgttggatgaggaccagaaagttcggcccaatgaagaaaacaataaggacgcagacttgtacacgtccagggtgatgctcagtagtcaagtgcctttggagcctcctcttctctttctgctggaggaatacaaaaattacctagacgctgcaaacatgtccatgagggtccggcgccactctgaccctgcccgccgaggggagctgagcgtgtgtgacagtattagtgagtgggtaacggcggcagacaaaaagactgcagtggacatgtcgggcgggacggtcacagtccttgaaaaggtccctgtatcaaaaggccaactgaagcaatacttctacgagaccaagtgcaatcccatgggttacacaaaagaaggctgcaggggcatagacaaaaggcattggaactcccagtgccgaactacccagtcgtacgtgcgggcccttaccatggatagcaaaaagagaattggctggcgattcataaggatagacacttcttgtgtatgtacattgaccattaaaaggggaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cell division cycle associated 5
- hypothetical protein FLJ20433
- chloride intracellular channel 4
- hydrogen voltage-gated channel 1

Buy BDNF-brain-derived neurotrophic factor Gene now

Add to cart