Login to display prices
Login to display prices
BDNF-brain-derived neurotrophic factor Gene View larger

BDNF-brain-derived neurotrophic factor Gene

PTXBC029795

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BDNF-brain-derived neurotrophic factor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BDNF-brain-derived neurotrophic factor Gene

Proteogenix catalog: PTXBC029795
Ncbi symbol: BDNF
Product name: BDNF-brain-derived neurotrophic factor Gene
Size: 2ug
Accessions: BC029795
Gene id: 627
Gene description: brain-derived neurotrophic factor
Synonyms: ANON2; BULN2; brain-derived neurotrophic factor; abrineurin; neurotrophin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccatccttttccttactatggttatttcatactttggttgcatgaaggctgcccccatgaaagaagcaaacatccgaggacaaggtggcttggcctacccaggtgtgcggacccatgggactctggagagcgtgaatgggcccaaggcaggttcaagaggcttgacatcattggctgacactttcgaacacatgatagaagagctgttggatgaggaccagaaagttcggcccaatgaagaaaacaataaggacgcagacttgtacacgtccagggtgatgctcagtagtcaagtgcctttggagcctcctcttctctttctgctggaggaatacaaaaattacctagacgctgcaaacatgtccatgagggtccggcgccactctgaccctgcccgccgaggggagctgagcgtgtgtgacagtattagtgagtgggtaacggcggcagacaaaaagactgcagtggacatgtcgggcgggacggtcacagtccttgaaaaggtccctgtatcaaaaggccaactgaagcaatacttctacgagaccaagtgcaatcccatgggttacacaaaagaaggctgcaggggcatagacaaaaggcattggaactcccagtgccgaactacccagtcgtacgtgcgggcccttaccatggatagcaaaaagagaattggctggcgattcataaggatagacacttcttgtgtatgtacattgaccattaaaaggggaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: