Login to display prices
Login to display prices
CLIC4-chloride intracellular channel 4 Gene View larger

CLIC4-chloride intracellular channel 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CLIC4-chloride intracellular channel 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CLIC4-chloride intracellular channel 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012444
Product type: DNA & cDNA
Ncbi symbol: CLIC4
Origin species: Human
Product name: CLIC4-chloride intracellular channel 4 Gene
Size: 2ug
Accessions: BC012444
Gene id: 25932
Gene description: chloride intracellular channel 4
Synonyms: CLIC4L; MTCLIC; huH1; p64H1; chloride intracellular channel protein 4; chloride intracellular channel 4 like; intracellular chloride ion channel protein p64H1; chloride intracellular channel 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgttgtcgatgccgctgaatgggctgaaggaggaggacaaagagcccctcatcgagctcttcgtcaaggctggcagtgatggtgaaagcataggaaactgccccttttcccagaggctcttcatgattctttggctcaaaggagttgtatttagtgtgacgactgttgacctgaaaaggaagccagcagacctgcagaacttggctcccgggacccacccaccatttataactttcaacagtgaagtcaaaacggatgtaaataagattgaggaatttcttgaagaagtcttatgccctcccaagtacttaaagctttcaccaaaacacccagaatcaaatactgctggaatggacatctttgccaaattctctgcatatatcaagaattcaaggccagaggctaatgaagcactggagaggggtctcctgaaaaccctgcagaaactggatgaatatctgaattctcctctccctgatgaaattgatgaaaatagtatggaggacataaagttttctacacgtaaatttctggatggcaatgaaatgacattagctgattgcaacctgctgcccaaactgcatattgtcaaggtggtggccaaaaaatatcgcaactttgatattccaaaagaaatgactggcatctggagatacctaactaatgcatacagtagggacgagttcaccaatacctgtcccagtgataaggaggttgaaatagcatatagtgatgtagccaaaagactcaccaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hydrogen voltage-gated channel 1
- thioredoxin domain containing 1
- ELMO/CED-12 domain containing 1
- methylthioadenosine phosphorylase