Login to display prices
Login to display prices
TXNDC1-thioredoxin domain containing 1 Gene View larger

TXNDC1-thioredoxin domain containing 1 Gene

PTXBC036460

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC1-thioredoxin domain containing 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC1-thioredoxin domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036460
Product type: DNA & cDNA
Ncbi symbol: TXNDC1
Origin species: Human
Product name: TXNDC1-thioredoxin domain containing 1 Gene
Size: 2ug
Accessions: BC036460
Gene id: 81542
Gene description: thioredoxin domain containing 1
Synonyms: TXNDC1; PDIA11; TMX; TXNDC; thioredoxin-related transmembrane protein 1; protein disulfide isomerase family A, member 11; thioredoxin domain containing 1; thioredoxin domain-containing protein 1; transmembrane Trx-related protein; thioredoxin related transmembrane protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgccctccgggagtcttgcagttcccctggcagtcatggtgccgttgctttggggtgctccctggacgcacgggcggcggagcaacgttcgcgtcatcacggacgagaactggagagaactgctggaaggagactggatgatagaattttatgccccgtggtgccctgcttgtcaaaatcttcaaccggaatgggaaagttttgctgaatggggagaagatcttgaggttaatattgcgaaagtagatgtcacagagcagccaggactgagtggacggtttatcataaatgctcttcctactatttatcattgtaaagatggtgaatttaggcgctatcagggtccaaggactaagaaggacttcataaactttataagtgataaagagtggaagagtattgagcccgtttcatcatggtttggtccaggttctgttctgatgagtagtatgtcagcactctttcagctatctatgtggatcaggacgtgccataactactttattgaagaccttggattgccagtgtggggatcatatactgtttttgctttagcaactctgttttccggactgttattaggactctgtatgatatttgtggcagattgcctttgtccttcaaaaaggcgcagaccacagccatacccatacccttcaaaaaaattattatcagaatctgcacaacctttgaaaaaagtggaggaggaacaagaggcggatgaagaagatgtttcagaagaagaagctgaaagtaaagaaggaacaaacaaagactttccacagaatgccataagacaacgctctctgggtccatcattggccacagataaatcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ELMO/CED-12 domain containing 1
- methylthioadenosine phosphorylase
- penta-EF-hand domain containing 1
- tetratricopeptide repeat domain 1